ID: 1104144687

View in Genome Browser
Species Human (GRCh38)
Location 12:126021439-126021461
Sequence TGGATGCAAATGCTTCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104144687_1104144691 2 Left 1104144687 12:126021439-126021461 CCCACAAGAAGCATTTGCATCCA No data
Right 1104144691 12:126021464-126021486 CAATGGACTTTTATTACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104144687 Original CRISPR TGGATGCAAATGCTTCTTGT GGG (reversed) Intergenic
No off target data available for this crispr