ID: 1104149644

View in Genome Browser
Species Human (GRCh38)
Location 12:126070405-126070427
Sequence TCTGTACTCAGACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104149644_1104149645 1 Left 1104149644 12:126070405-126070427 CCAGATTTTGGTCTGAGTACAGA No data
Right 1104149645 12:126070429-126070451 AGCAAGAGTTAATATAGAAGTGG No data
1104149644_1104149647 3 Left 1104149644 12:126070405-126070427 CCAGATTTTGGTCTGAGTACAGA No data
Right 1104149647 12:126070431-126070453 CAAGAGTTAATATAGAAGTGGGG No data
1104149644_1104149646 2 Left 1104149644 12:126070405-126070427 CCAGATTTTGGTCTGAGTACAGA No data
Right 1104149646 12:126070430-126070452 GCAAGAGTTAATATAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104149644 Original CRISPR TCTGTACTCAGACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr