ID: 1104157865

View in Genome Browser
Species Human (GRCh38)
Location 12:126150897-126150919
Sequence CTCTTCTGATCTGCCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104157865_1104157867 -9 Left 1104157865 12:126150897-126150919 CCAGGAGAGGCAGATCAGAAGAG No data
Right 1104157867 12:126150911-126150933 TCAGAAGAGGAGAGTGAATCAGG No data
1104157865_1104157868 15 Left 1104157865 12:126150897-126150919 CCAGGAGAGGCAGATCAGAAGAG No data
Right 1104157868 12:126150935-126150957 GAGTCCTAGAGACGCAGCAGAGG No data
1104157865_1104157871 22 Left 1104157865 12:126150897-126150919 CCAGGAGAGGCAGATCAGAAGAG No data
Right 1104157871 12:126150942-126150964 AGAGACGCAGCAGAGGAGGCAGG No data
1104157865_1104157869 18 Left 1104157865 12:126150897-126150919 CCAGGAGAGGCAGATCAGAAGAG No data
Right 1104157869 12:126150938-126150960 TCCTAGAGACGCAGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104157865 Original CRISPR CTCTTCTGATCTGCCTCTCC TGG (reversed) Intergenic