ID: 1104157868

View in Genome Browser
Species Human (GRCh38)
Location 12:126150935-126150957
Sequence GAGTCCTAGAGACGCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104157865_1104157868 15 Left 1104157865 12:126150897-126150919 CCAGGAGAGGCAGATCAGAAGAG No data
Right 1104157868 12:126150935-126150957 GAGTCCTAGAGACGCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104157868 Original CRISPR GAGTCCTAGAGACGCAGCAG AGG Intergenic