ID: 1104159159

View in Genome Browser
Species Human (GRCh38)
Location 12:126161938-126161960
Sequence ATATGTGAGTGGAGCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104159159_1104159162 -3 Left 1104159159 12:126161938-126161960 CCCTCTGGGCTCCACTCACATAT No data
Right 1104159162 12:126161958-126161980 TATTCCTTTCCATTCACTTCTGG No data
1104159159_1104159165 11 Left 1104159159 12:126161938-126161960 CCCTCTGGGCTCCACTCACATAT No data
Right 1104159165 12:126161972-126161994 CACTTCTGGCCCAGAGCTAGTGG No data
1104159159_1104159166 12 Left 1104159159 12:126161938-126161960 CCCTCTGGGCTCCACTCACATAT No data
Right 1104159166 12:126161973-126161995 ACTTCTGGCCCAGAGCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104159159 Original CRISPR ATATGTGAGTGGAGCCCAGA GGG (reversed) Intergenic
No off target data available for this crispr