ID: 1104159889

View in Genome Browser
Species Human (GRCh38)
Location 12:126168188-126168210
Sequence CCTGCAGGAGGGTGTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104159889_1104159902 20 Left 1104159889 12:126168188-126168210 CCCCACCCACACCCTCCTGCAGG No data
Right 1104159902 12:126168231-126168253 GCCATTGATATCAAAGCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104159889 Original CRISPR CCTGCAGGAGGGTGTGGGTG GGG (reversed) Intergenic