ID: 1104172271

View in Genome Browser
Species Human (GRCh38)
Location 12:126293335-126293357
Sequence CTCTTGTAACTGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104172269_1104172271 25 Left 1104172269 12:126293287-126293309 CCATAGATAAATCACTTAGGAAG No data
Right 1104172271 12:126293335-126293357 CTCTTGTAACTGAATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104172271 Original CRISPR CTCTTGTAACTGAATGAAGA TGG Intergenic
No off target data available for this crispr