ID: 1104176521

View in Genome Browser
Species Human (GRCh38)
Location 12:126338321-126338343
Sequence CAGAGTCATGTATGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104176521_1104176525 11 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176525 12:126338355-126338377 GGTTATCGGATTATTCAGCCAGG No data
1104176521_1104176527 21 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176527 12:126338365-126338387 TTATTCAGCCAGGAAGAAGGAGG No data
1104176521_1104176523 -3 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG No data
1104176521_1104176529 26 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176529 12:126338370-126338392 CAGCCAGGAAGAAGGAGGGATGG No data
1104176521_1104176526 18 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176526 12:126338362-126338384 GGATTATTCAGCCAGGAAGAAGG No data
1104176521_1104176522 -10 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176522 12:126338334-126338356 CATGACTCTGTATCCACTGATGG No data
1104176521_1104176528 22 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176528 12:126338366-126338388 TATTCAGCCAGGAAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104176521 Original CRISPR CAGAGTCATGTATGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr