ID: 1104176523 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:126338341-126338363 |
| Sequence | CTGTATCCACTGATGGTTAT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104176520_1104176523 | -2 | Left | 1104176520 | 12:126338320-126338342 | CCCTTTCTCTCATACATGACTCT | No data | ||
| Right | 1104176523 | 12:126338341-126338363 | CTGTATCCACTGATGGTTATCGG | No data | ||||
| 1104176519_1104176523 | 2 | Left | 1104176519 | 12:126338316-126338338 | CCAACCCTTTCTCTCATACATGA | No data | ||
| Right | 1104176523 | 12:126338341-126338363 | CTGTATCCACTGATGGTTATCGG | No data | ||||
| 1104176521_1104176523 | -3 | Left | 1104176521 | 12:126338321-126338343 | CCTTTCTCTCATACATGACTCTG | No data | ||
| Right | 1104176523 | 12:126338341-126338363 | CTGTATCCACTGATGGTTATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104176523 | Original CRISPR | CTGTATCCACTGATGGTTAT CGG | Intergenic | ||
| No off target data available for this crispr | |||||