ID: 1104176525

View in Genome Browser
Species Human (GRCh38)
Location 12:126338355-126338377
Sequence GGTTATCGGATTATTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104176521_1104176525 11 Left 1104176521 12:126338321-126338343 CCTTTCTCTCATACATGACTCTG No data
Right 1104176525 12:126338355-126338377 GGTTATCGGATTATTCAGCCAGG No data
1104176519_1104176525 16 Left 1104176519 12:126338316-126338338 CCAACCCTTTCTCTCATACATGA No data
Right 1104176525 12:126338355-126338377 GGTTATCGGATTATTCAGCCAGG No data
1104176520_1104176525 12 Left 1104176520 12:126338320-126338342 CCCTTTCTCTCATACATGACTCT No data
Right 1104176525 12:126338355-126338377 GGTTATCGGATTATTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104176525 Original CRISPR GGTTATCGGATTATTCAGCC AGG Intergenic
No off target data available for this crispr