ID: 1104178078

View in Genome Browser
Species Human (GRCh38)
Location 12:126351900-126351922
Sequence CAGCTGAGGTCACACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104178078_1104178085 14 Left 1104178078 12:126351900-126351922 CCAGGCCTGTGTGACCTCAGCTG No data
Right 1104178085 12:126351937-126351959 AGAAACCTGATTCCAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104178078 Original CRISPR CAGCTGAGGTCACACAGGCC TGG (reversed) Intergenic
No off target data available for this crispr