ID: 1104178950

View in Genome Browser
Species Human (GRCh38)
Location 12:126359432-126359454
Sequence GTGATTAGACAGATGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104178950_1104178954 19 Left 1104178950 12:126359432-126359454 CCATCTCACATCTGTCTAATCAC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1104178954 12:126359474-126359496 GCCCAACTGGCCTACGTACATGG 0: 1
1: 0
2: 0
3: 0
4: 24
1104178950_1104178953 6 Left 1104178950 12:126359432-126359454 CCATCTCACATCTGTCTAATCAC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1104178953 12:126359461-126359483 TCAAATGTGATGGGCCCAACTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1104178950_1104178952 -3 Left 1104178950 12:126359432-126359454 CCATCTCACATCTGTCTAATCAC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1104178952 12:126359452-126359474 CACATTCATTCAAATGTGATGGG 0: 1
1: 0
2: 1
3: 25
4: 191
1104178950_1104178951 -4 Left 1104178950 12:126359432-126359454 CCATCTCACATCTGTCTAATCAC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1104178951 12:126359451-126359473 TCACATTCATTCAAATGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104178950 Original CRISPR GTGATTAGACAGATGTGAGA TGG (reversed) Intergenic
904254829 1:29248260-29248282 GGGATTAGACAGGCCTGAGATGG + Intronic
905358672 1:37403195-37403217 GTGAATGATCAGATGTGAGAGGG - Intergenic
905388546 1:37621453-37621475 GGGAGTAGACACACGTGAGATGG + Intronic
905926256 1:41751969-41751991 GTGAGAAGACAAATGTGATATGG - Intronic
908032089 1:60011899-60011921 ATGATTAGACAGATAAGTGATGG + Intronic
908986742 1:70032871-70032893 GTGAGGAGACAGAAATGAGAGGG - Intronic
910436623 1:87212022-87212044 GGGATTGGACAGGAGTGAGAGGG - Intergenic
911005881 1:93223215-93223237 GTTAATAGCCAGATATGAGATGG + Intronic
912123331 1:106501722-106501744 GAGATGAGACAGCTGTGAGATGG - Intergenic
912570491 1:110617708-110617730 GTGATCAGCGAGATGGGAGAGGG + Intronic
917453645 1:175167634-175167656 GTGAGAGGACAGATGGGAGAGGG + Intronic
918142134 1:181728255-181728277 GGGTTTAGAGAGATGTGAGTTGG + Intronic
919264968 1:195251421-195251443 GTGATTAGACAAATATCGGATGG + Intergenic
919706572 1:200681936-200681958 TTGATTATACAGGTGAGAGAGGG + Intergenic
920959719 1:210653649-210653671 GGGATTAGACAGAGGAGTGAGGG + Intronic
1062832517 10:615270-615292 GTGATTAGACAGAAGACAGAAGG + Intronic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064648034 10:17480072-17480094 GTGGTTAGAAAGAGGTGAGGAGG - Intergenic
1067180367 10:43980859-43980881 GTGATTAGACACGTGTTAGTTGG - Intergenic
1068099760 10:52537532-52537554 GATATTAGACAAATGTCAGATGG + Intergenic
1068183089 10:53547555-53547577 GAGATAAAACAGATGTGAGTTGG + Intergenic
1068250785 10:54437047-54437069 CTAATTAGACAGGTGTGACAAGG - Intronic
1071354950 10:84784654-84784676 GTGTTCAGACAGGGGTGAGAAGG + Intergenic
1074608659 10:115000042-115000064 TTGTTCAGACAGATGTGAAAAGG + Intergenic
1074905616 10:117860800-117860822 GTGATTAGACCTATGAGGGAAGG - Intergenic
1076573024 10:131444817-131444839 GTGAGTACACAGGGGTGAGATGG + Intergenic
1077782839 11:5350550-5350572 GGGATTTGACAAAAGTGAGAAGG - Intronic
1078630974 11:13004053-13004075 GGAATTAGCCAGATGTCAGAGGG + Intergenic
1078739701 11:14055105-14055127 GTGATTGGACACATGACAGATGG - Intronic
1078936010 11:15950943-15950965 TTGATTAGACTGTTGGGAGAGGG - Intergenic
1080582196 11:33652823-33652845 GTCATTAGACAGATAAGTGAAGG + Intronic
1082059235 11:47846473-47846495 GTGACTAACCAGATGTGAGTGGG - Intronic
1083278903 11:61613500-61613522 CTGTTTATACAGATGTGAGGTGG + Intergenic
1084066308 11:66706305-66706327 GTGATTAGAAGGTTTTGAGAGGG - Intronic
1085813226 11:79705740-79705762 ATTATTAAAAAGATGTGAGATGG - Intergenic
1088467067 11:110151879-110151901 ATGATTAGCCATATGTTAGATGG + Intronic
1090218492 11:124993581-124993603 GTGATATGAGAGATGAGAGATGG + Intronic
1090613599 11:128494420-128494442 GTATTTAGACAGAAGTGAGCAGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1093422018 12:18984399-18984421 GTAGTTAGGCAGATGTGAGCAGG - Intergenic
1093857969 12:24128561-24128583 GTGGTGAGGCAGATGTGAGAAGG + Intergenic
1093947683 12:25129066-25129088 GTCATAAAACAGAAGTGAGAAGG - Intronic
1094382403 12:29857049-29857071 TTGCCTAGTCAGATGTGAGATGG - Intergenic
1096877910 12:54644876-54644898 GTGCTTACACAGAAGTCAGAGGG + Intronic
1097610757 12:61816837-61816859 GTGTTCAGTCAGATGTGAGAAGG - Intronic
1097855680 12:64459301-64459323 GTGATTGGAAGGAAGTGAGAGGG + Intronic
1098541890 12:71666179-71666201 TTGATTGGATAGATGAGAGAGGG + Intronic
1098994393 12:77101596-77101618 GTAGTTAGGCAGATGAGAGACGG + Intergenic
1101124211 12:101614381-101614403 GTGAGTACACACAGGTGAGATGG + Intronic
1102748769 12:115273567-115273589 GTGAGGAGACAGGTGTGAAAGGG + Intergenic
1103868254 12:124071382-124071404 TTGATTAGTCAAATATGAGAAGG - Intronic
1104178950 12:126359432-126359454 GTGATTAGACAGATGTGAGATGG - Intergenic
1104310291 12:127648713-127648735 GTGGTTAGATAGATGTGTGATGG - Intergenic
1105832310 13:24174413-24174435 GAGATTAGATTGATTTGAGATGG + Intronic
1105912151 13:24879110-24879132 GTGAATGGCCAGATATGAGAGGG + Intronic
1106626611 13:31427146-31427168 GTGTTTAGAAAGATTTGAGCTGG - Intergenic
1107197772 13:37674331-37674353 GAAATTAAACAGATGTGGGATGG - Exonic
1108274649 13:48795586-48795608 GTGACTTAACAGATATGAGAAGG + Intergenic
1109668931 13:65578372-65578394 GAGATTATGAAGATGTGAGAAGG + Intergenic
1110207949 13:72939400-72939422 GTGATTTGGCAGTTGTCAGAGGG - Intronic
1111798325 13:92951945-92951967 CAGATTAGAAAGATATGAGATGG + Intergenic
1112435682 13:99389953-99389975 GTGAGGAGACAGATCAGAGAAGG + Intergenic
1117242734 14:53851285-53851307 GAGGTTAGACAGTTGGGAGAAGG - Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1123879047 15:24657322-24657344 GGGATCAGTCATATGTGAGAAGG + Intergenic
1123970254 15:25501721-25501743 GTTATTAGAAAGATGAAAGAGGG - Intergenic
1124085143 15:26542577-26542599 GTGATGAGACAGGAGTGAGGAGG + Intergenic
1125408362 15:39378425-39378447 GTGTTTTGATAGGTGTGAGATGG - Intergenic
1126994234 15:54421523-54421545 CTGATTAGGTAGATGTGGGATGG - Intronic
1127476841 15:59342268-59342290 GTGATTAAACCCTTGTGAGATGG + Intronic
1127544194 15:59975027-59975049 GTGAGCAGACAGATGTGATCAGG + Intergenic
1127808571 15:62543446-62543468 ATGATGAGACAGATGTAAGATGG + Intronic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1128784729 15:70386327-70386349 GAGATAAGACAGATTTGAAAGGG - Intergenic
1129150805 15:73686681-73686703 GTGATAAGAGAGCTGTGAGTTGG + Intronic
1129904162 15:79174259-79174281 ATGAAGTGACAGATGTGAGAAGG + Intergenic
1132132603 15:99296847-99296869 GGGATTAGACAGGAGAGAGAAGG + Intronic
1134075185 16:11285782-11285804 GTGTTCATACAGGTGTGAGATGG + Intronic
1134643977 16:15851714-15851736 ATGATTAGGCAGATGTCACAAGG - Intronic
1135895702 16:26400299-26400321 GAGATCTGACAGATGAGAGAGGG + Intergenic
1137501472 16:49014741-49014763 GTGATTAGACAGATTGGAAGTGG + Intergenic
1139229146 16:65265869-65265891 ACAATTAGCCAGATGTGAGATGG - Intergenic
1141274559 16:82574990-82575012 ATAACTAGAAAGATGTGAGAAGG - Intergenic
1145289538 17:21532372-21532394 GTGATGAGACAGACGGGAGAGGG - Exonic
1145355529 17:22144280-22144302 TTGATTAGACAGAAGTAAAATGG - Intergenic
1149290704 17:55215295-55215317 GTAATTAGGCAGATATGAGCAGG + Intergenic
1149565329 17:57637010-57637032 GTGATGAGACAGATGTGTGGGGG - Intronic
1150200634 17:63353495-63353517 TTGAGTAGACAGATATAAGATGG + Intronic
1150996054 17:70318883-70318905 GAGACTGGACAGATGTGAGGGGG - Intergenic
1151625491 17:75272948-75272970 GTGAGTAGGCAGATGTGCCAGGG + Intergenic
1203169349 17_GL000205v2_random:133806-133828 GATATTAGACATTTGTGAGATGG - Intergenic
1153350879 18:4079961-4079983 ATGATTAGATAGATGTTATATGG + Intronic
1153755309 18:8276647-8276669 GTGGTGACACAGATATGAGATGG - Intronic
1155554269 18:27000899-27000921 GTGATTAGACAATTCAGAGATGG - Intronic
1156812530 18:41270024-41270046 CTGATTTGGCAGATGTGAAAAGG - Intergenic
1157526208 18:48384496-48384518 GTGGTTAGAAAGTTGGGAGAGGG + Intronic
1159421326 18:68224318-68224340 GAGATATGCCAGATGTGAGAGGG + Intergenic
1159972612 18:74672239-74672261 GTTATTTGACTGATGTGAGATGG + Intronic
1162156933 19:8684558-8684580 GTTCTTAGACAGAGGGGAGAGGG + Intergenic
1165222437 19:34327933-34327955 GTGTTTTGACAGATGAGCGATGG + Intronic
1165778197 19:38417280-38417302 GGGATCAGACAGGTGAGAGAAGG + Intronic
1168097921 19:54125958-54125980 GTGCCTGGACCGATGTGAGATGG - Intronic
925648266 2:6060810-6060832 TTCATTGGACAGATGGGAGAAGG + Intergenic
926239193 2:11071761-11071783 TTGATTAGAGAGATGAGAGATGG + Intergenic
927249814 2:20987492-20987514 GTGATTAGGAAGATGTGTGCCGG + Intergenic
929673704 2:43903115-43903137 ATCTTTAGACAGATGTGAAATGG - Intronic
929781889 2:44962444-44962466 GTGAGAAGACAGATGGGATAGGG - Intergenic
930360489 2:50371998-50372020 GTACTTAGACCAATGTGAGAAGG - Intronic
931925241 2:67065289-67065311 GGGATTCGTCAGTTGTGAGAAGG + Intergenic
933028294 2:77291142-77291164 TTTATTATACAGATGAGAGATGG + Intronic
934665590 2:96167764-96167786 GTAGTTAGACAGACGTGAGCCGG + Intergenic
937876884 2:126832710-126832732 CTTATTAGGCAGATGTGAGAGGG - Intergenic
938593953 2:132767630-132767652 GTAACTACACAGATGTGAGTTGG + Intronic
939437787 2:142200859-142200881 GTGATTAGACAAAAGGAAGAAGG - Intergenic
939733610 2:145816025-145816047 GTGATGAGACAGATGCAACAGGG + Intergenic
940161922 2:150722849-150722871 GTGATGAGAGATTTGTGAGAGGG + Intergenic
941414324 2:165200625-165200647 TTGATTAGGCAGATCTGAGAGGG - Intronic
942845883 2:180424584-180424606 GTAAGGAGAGAGATGTGAGATGG - Intergenic
943440770 2:187924898-187924920 AGGTTTAGTCAGATGTGAGAAGG + Intergenic
943653318 2:190480529-190480551 GTGATTTTACAGATGTGTTATGG - Intronic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
943997037 2:194782462-194782484 GTGATTAGATAGGTTTGATATGG - Intergenic
944280726 2:197893560-197893582 GTGACTTTACAAATGTGAGAAGG + Intronic
945657069 2:212637516-212637538 GAAATCAGACAAATGTGAGAAGG + Intergenic
1170029210 20:11927292-11927314 GTGATTAAACTGATGAGAGTGGG - Intergenic
1173274840 20:41571138-41571160 GTGATTTGTCAGCTGTGAGAAGG + Intronic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1176402409 21:6325343-6325365 GATATTAGACATTTGTGAGATGG + Intergenic
1176434748 21:6663761-6663783 GATATTAGACATTTGTGAGATGG - Intergenic
1176459010 21:6990831-6990853 GATATTAGACATTTGTGAGATGG - Intergenic
1177257267 21:18681781-18681803 GAGACTGGACAGATGTCAGAGGG + Intergenic
1178825188 21:36009490-36009512 GTTATAAGACAAATGTGAAAGGG - Intergenic
1179069502 21:38058546-38058568 GAGATTGGGCAGATGTGAAAGGG - Intronic
1182458968 22:30470899-30470921 GTGAATGGACAGAGGAGAGATGG + Intronic
1182837882 22:33359248-33359270 GGAATCAGACAGATGTGAGTTGG + Intronic
1182981284 22:34673842-34673864 GTGGTTAGACACATGAGAGTAGG + Intergenic
1183523352 22:38309346-38309368 GTGATTCGGCAGATGTGTGCAGG + Intronic
949180124 3:1119020-1119042 GTAGTTAGAAAGATGGGAGATGG - Intronic
953558828 3:43968629-43968651 GTGATTCGGCAGATCTGAGAGGG + Intergenic
954618937 3:51984897-51984919 GTGATTAATCAGCTGAGAGATGG + Intronic
957908912 3:86595836-86595858 GTGATTAGAAAGATGTTTTAAGG + Intergenic
959749097 3:109812073-109812095 GACATGAGACAGATGGGAGAGGG + Intergenic
959964782 3:112340915-112340937 GTAGGTAGACAGATGAGAGAAGG - Exonic
960596418 3:119411962-119411984 GTGATTAGAGCTAGGTGAGAAGG + Intronic
960725339 3:120664247-120664269 GAGAGAAGACAGATGTGAGAGGG + Intronic
961032401 3:123618092-123618114 GTGAGGGGACATATGTGAGAAGG - Intronic
961935344 3:130577028-130577050 GTGATTCAACATATGTGAAAGGG + Intronic
962203393 3:133417145-133417167 GTGAGTAGAGAGATGAGAGAGGG - Intronic
962911109 3:139850520-139850542 GTATTTTGACTGATGTGAGATGG + Intergenic
963255119 3:143137201-143137223 GTAATTATCCACATGTGAGAAGG - Intergenic
965473210 3:169121009-169121031 GGGAAGAGACAGATGTGGGAAGG + Intronic
966578078 3:181525936-181525958 GTGAATAGACAGAAGTGGGTTGG - Intergenic
967688067 3:192440424-192440446 GTGATTAGTCAGATGGGATTTGG + Intronic
969199614 4:5592435-5592457 GTAACTAGTCAGATGTGAGCAGG + Intronic
969510725 4:7616315-7616337 GTGAATGGACAGATGACAGATGG - Intronic
970151940 4:13099129-13099151 TTGTTTAGAGTGATGTGAGATGG - Intergenic
974125354 4:57689707-57689729 GTGATCAGACAGATATCACAAGG + Intergenic
975870208 4:78771859-78771881 GTGAATACAAAGATGTGGGAAGG - Intergenic
976201907 4:82587194-82587216 GTGATGAGACAGAAAAGAGAAGG - Intergenic
977673369 4:99721090-99721112 GTTGTTAGAAAGATCTGAGATGG - Intergenic
978370838 4:108028162-108028184 GTGATTAGAAATATGTGACAAGG + Intronic
982895883 4:160924842-160924864 CTGATTAGACAGATGAGTTAAGG - Intergenic
983028226 4:162764471-162764493 GTAATAAGTAAGATGTGAGAGGG + Intergenic
983481955 4:168285825-168285847 GTAAGTAGACAGATGACAGATGG + Intronic
983637923 4:169917037-169917059 GTGAGTGGACAGATGTCAGCTGG + Intergenic
984360847 4:178729776-178729798 ATCATTAGATAAATGTGAGATGG - Intergenic
984559416 4:181251076-181251098 GTGATTAGTGAGATAGGAGAGGG - Intergenic
984863890 4:184264094-184264116 GTGATCAGACAGAAGGGTGATGG - Intergenic
986326116 5:6675977-6675999 GTAATTAGGCAGATATGAGCAGG + Intergenic
988233164 5:28506105-28506127 GTGATCAGCCAGATGTGTGGTGG - Intergenic
989356990 5:40554627-40554649 ATGATTTGACAGAGGTGAGGGGG - Intergenic
993810128 5:92465204-92465226 TTATTTAGACAGATGTGATAAGG - Intergenic
1000268664 5:159661959-159661981 GTGTCTAGACAGGTGTGGGAGGG - Intergenic
1000269440 5:159669606-159669628 AGAATTAAACAGATGTGAGAAGG + Intergenic
1000606155 5:163329926-163329948 TTGTTGAGAAAGATGTGAGACGG - Intergenic
1002569964 5:180134645-180134667 GTGAGTGGGCAGATGTTAGAAGG - Intronic
1007582713 6:42968774-42968796 GTGAGTAGACAGAGGAGGGAGGG + Intronic
1008023037 6:46601941-46601963 GTGATTAGGGAGATGTTAGTTGG - Intronic
1009520301 6:64673282-64673304 TTGATAAGACATATATGAGATGG + Intronic
1011497018 6:87946834-87946856 GACATGAGACAGAAGTGAGATGG + Intergenic
1011623091 6:89260903-89260925 GAGAGCAGACAGAGGTGAGAAGG - Intronic
1013010304 6:106114477-106114499 GTGAGCAGATAGATGTGAAAGGG + Intergenic
1013435150 6:110097247-110097269 ATGAAAATACAGATGTGAGATGG + Intergenic
1013877047 6:114844791-114844813 GTCATCTGACAGGTGTGAGAAGG - Intergenic
1017288222 6:152702930-152702952 ATGATTCAACAGATGTGAGATGG + Intronic
1018053267 6:160030096-160030118 GTGATGAGAAAGAGGGGAGAAGG - Intronic
1018739176 6:166714342-166714364 GGGAAGAGACAGCTGTGAGATGG + Intronic
1020290772 7:6720862-6720884 GTGGTTGGACAAATGTGAGGAGG - Intergenic
1022217269 7:28276081-28276103 GAGACTACAGAGATGTGAGAAGG - Intergenic
1022965279 7:35466398-35466420 TTAATTAGAAAGATGTGAGCAGG - Intergenic
1026130458 7:67616493-67616515 GTAATCAGACAGACGTGAGAAGG + Intergenic
1028294739 7:89114645-89114667 TTGATTACACAGATGTGAAAAGG + Intronic
1031067089 7:117116714-117116736 GTGATATGACAGACCTGAGAAGG + Intronic
1032990426 7:137388963-137388985 GTATTTAGAGAAATGTGAGATGG + Intronic
1032997917 7:137468923-137468945 ATGAATATACAGAGGTGAGAAGG + Intronic
1033000343 7:137497245-137497267 GCGATTTGACTGGTGTGAGATGG - Intronic
1033872944 7:145779188-145779210 GTGAGTAGACAGATTAGGGAAGG + Intergenic
1035762983 8:2083469-2083491 GCCATTAGACATATGCGAGATGG - Intronic
1035910857 8:3564783-3564805 GTGATGACAGAGGTGTGAGAGGG + Intronic
1037617599 8:20533670-20533692 GTGATGAAACAGAGGTGACAGGG + Intergenic
1037643130 8:20766794-20766816 CTCACAAGACAGATGTGAGAAGG - Intergenic
1038691445 8:29767400-29767422 GTGATTAGACAGTTGTTTGGGGG + Intergenic
1039320822 8:36428744-36428766 GTGAAGAGCCAGATGTTAGAGGG - Intergenic
1039888816 8:41670950-41670972 GAGATGAGACAGACATGAGATGG - Intronic
1041279332 8:56195620-56195642 GGGGTGAGACAGATGTGAGGAGG + Intronic
1043827851 8:84950411-84950433 GTGAATAGAAACATGGGAGATGG + Intergenic
1045975479 8:108126629-108126651 GATATTAGACCTATGTGAGATGG - Intergenic
1047862641 8:128985144-128985166 CTGTTTACAAAGATGTGAGAAGG - Intergenic
1048539116 8:135326413-135326435 GTGGTTACACAGGTCTGAGAGGG + Intergenic
1049160122 8:141091964-141091986 GTGATGAGTCAGGTGTGGGAAGG + Intergenic
1052691050 9:31817440-31817462 ATGATTAGACAGATGTGGTGGGG - Intergenic
1053276681 9:36788458-36788480 ATGGATAGACAGATGTGTGAAGG + Intergenic
1053426663 9:38014605-38014627 GAGATTAGAAAGATGGGAGTGGG + Intronic
1054846445 9:69803444-69803466 GTCAATAGCCAGATGGGAGATGG + Intergenic
1055803662 9:80068868-80068890 GTGATAAAACAGATGTTAGCAGG + Intergenic
1056074076 9:83020450-83020472 GTGTTTAGAAAGGTGTGAGGCGG + Intronic
1056989582 9:91398253-91398275 GTGGATAGACAGATGATAGATGG + Intergenic
1058804738 9:108579832-108579854 GTGGAATGACAGATGTGAGAAGG - Intergenic
1203436788 Un_GL000195v1:144884-144906 GATATTAGACATTTGTGAGATGG + Intergenic
1186426699 X:9468184-9468206 GGGATCAGAGAGATTTGAGATGG + Intronic
1186935295 X:14443478-14443500 TTGATTGGAGAGATGTGATATGG - Intergenic
1187357571 X:18591521-18591543 GTGGTTTGAGAAATGTGAGAAGG - Intronic
1187718462 X:22127818-22127840 GCGTTTTGACAAATGTGAGAGGG + Intronic
1188027380 X:25224341-25224363 GTGATTAGACAAAAGAAAGAAGG - Intergenic
1188359194 X:29231689-29231711 CTGATTCGGGAGATGTGAGATGG + Intronic
1188930773 X:36108434-36108456 GTGATTAATTAGATGTAAGAAGG - Intronic
1190396912 X:49994314-49994336 GTGATTAGACAGATGTATGGTGG + Intronic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1191599337 X:62985501-62985523 GTATTTTGACTGATGTGAGATGG + Intergenic
1192047888 X:67695720-67695742 GTGTTTAGACAGACTGGAGAAGG - Intronic
1194366380 X:93019050-93019072 GTGATTAAGCAGGTGTGAGGTGG - Intergenic
1194648149 X:96483197-96483219 GTAGTTAGACAGATATGAGTGGG - Intergenic
1194961780 X:100244475-100244497 GTGTTTAAATAGAGGTGAGATGG - Intergenic
1196355959 X:114793007-114793029 GATATTAGACATATGTCAGATGG + Intronic
1198380268 X:136077072-136077094 GTGAGTATGCAGATGTGAGGAGG - Intergenic
1198428187 X:136540540-136540562 GTAAGAAGACAGACGTGAGAGGG - Intronic
1198856867 X:141027144-141027166 TTCAATAAACAGATGTGAGATGG + Intergenic
1198905827 X:141560223-141560245 TTCAATAAACAGATGTGAGATGG - Intergenic
1200008844 X:153106759-153106781 GCGATTGGGCAGATGTGAGATGG - Intergenic
1200030756 X:153293163-153293185 GCGATTGGGCAGATGTGAGATGG + Intergenic
1200674607 Y:6135312-6135334 GTGATTAAGCAGGTGTGAGGTGG - Intergenic