ID: 1104179852

View in Genome Browser
Species Human (GRCh38)
Location 12:126368743-126368765
Sequence CTGAGCAGTGAGAAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104179846_1104179852 21 Left 1104179846 12:126368699-126368721 CCTTAGAATTTTGGTCTGAGTGT No data
Right 1104179852 12:126368743-126368765 CTGAGCAGTGAGAAGGTGTGAGG No data
1104179845_1104179852 24 Left 1104179845 12:126368696-126368718 CCTCCTTAGAATTTTGGTCTGAG No data
Right 1104179852 12:126368743-126368765 CTGAGCAGTGAGAAGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104179852 Original CRISPR CTGAGCAGTGAGAAGGTGTG AGG Intergenic
No off target data available for this crispr