ID: 1104180552

View in Genome Browser
Species Human (GRCh38)
Location 12:126376179-126376201
Sequence GCCACTGGTCCCATTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104180552_1104180560 28 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data
1104180552_1104180558 3 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180558 12:126376205-126376227 TTAAGCAGAAGCCAGAGGGTTGG No data
1104180552_1104180555 -2 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180555 12:126376200-126376222 GCCTTTTAAGCAGAAGCCAGAGG No data
1104180552_1104180557 -1 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104180552 Original CRISPR GCCACTGGTCCCATTCATGA GGG (reversed) Intergenic
No off target data available for this crispr