ID: 1104180556

View in Genome Browser
Species Human (GRCh38)
Location 12:126376201-126376223
Sequence CCCTCTGGCTTCTGCTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104180556_1104180560 6 Left 1104180556 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104180556 Original CRISPR CCCTCTGGCTTCTGCTTAAA AGG (reversed) Intergenic
No off target data available for this crispr