ID: 1104180557

View in Genome Browser
Species Human (GRCh38)
Location 12:126376201-126376223
Sequence CCTTTTAAGCAGAAGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104180552_1104180557 -1 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG No data
1104180553_1104180557 -2 Left 1104180553 12:126376180-126376202 CCTCATGAATGGGACCAGTGGCC No data
Right 1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104180557 Original CRISPR CCTTTTAAGCAGAAGCCAGA GGG Intergenic
No off target data available for this crispr