ID: 1104180558

View in Genome Browser
Species Human (GRCh38)
Location 12:126376205-126376227
Sequence TTAAGCAGAAGCCAGAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104180553_1104180558 2 Left 1104180553 12:126376180-126376202 CCTCATGAATGGGACCAGTGGCC No data
Right 1104180558 12:126376205-126376227 TTAAGCAGAAGCCAGAGGGTTGG No data
1104180552_1104180558 3 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180558 12:126376205-126376227 TTAAGCAGAAGCCAGAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104180558 Original CRISPR TTAAGCAGAAGCCAGAGGGT TGG Intergenic
No off target data available for this crispr