ID: 1104180559

View in Genome Browser
Species Human (GRCh38)
Location 12:126376216-126376238
Sequence AAGACAGCGAGCCAACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104180559_1104180567 30 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180567 12:126376269-126376291 GAAGTCCACAACCTGGTAGGGGG No data
1104180559_1104180566 29 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180566 12:126376268-126376290 AGAAGTCCACAACCTGGTAGGGG No data
1104180559_1104180565 28 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180565 12:126376267-126376289 AAGAAGTCCACAACCTGGTAGGG No data
1104180559_1104180563 23 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180563 12:126376262-126376284 AAAGAAAGAAGTCCACAACCTGG No data
1104180559_1104180560 -9 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data
1104180559_1104180564 27 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180564 12:126376266-126376288 AAAGAAGTCCACAACCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104180559 Original CRISPR AAGACAGCGAGCCAACCCTC TGG (reversed) Intergenic
No off target data available for this crispr