ID: 1104180560

View in Genome Browser
Species Human (GRCh38)
Location 12:126376230-126376252
Sequence CGCTGTCTTTCCACCATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104180556_1104180560 6 Left 1104180556 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data
1104180559_1104180560 -9 Left 1104180559 12:126376216-126376238 CCAGAGGGTTGGCTCGCTGTCTT No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data
1104180552_1104180560 28 Left 1104180552 12:126376179-126376201 CCCTCATGAATGGGACCAGTGGC No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data
1104180554_1104180560 13 Left 1104180554 12:126376194-126376216 CCAGTGGCCTTTTAAGCAGAAGC No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data
1104180553_1104180560 27 Left 1104180553 12:126376180-126376202 CCTCATGAATGGGACCAGTGGCC No data
Right 1104180560 12:126376230-126376252 CGCTGTCTTTCCACCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104180560 Original CRISPR CGCTGTCTTTCCACCATGTG AGG Intergenic
No off target data available for this crispr