ID: 1104186462

View in Genome Browser
Species Human (GRCh38)
Location 12:126436760-126436782
Sequence CAGCTACTCTAGAGATCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104186461_1104186462 8 Left 1104186461 12:126436729-126436751 CCATGTGCAGTGGTGGGACTCGA No data
Right 1104186462 12:126436760-126436782 CAGCTACTCTAGAGATCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104186462 Original CRISPR CAGCTACTCTAGAGATCAAA AGG Intergenic
No off target data available for this crispr