ID: 1104187062

View in Genome Browser
Species Human (GRCh38)
Location 12:126442997-126443019
Sequence TTCCTGGACCTCCCACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187055_1104187062 4 Left 1104187055 12:126442970-126442992 CCCTATGATCCAGACCTCAAGAG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG 0: 1
1: 0
2: 3
3: 25
4: 238
1104187056_1104187062 3 Left 1104187056 12:126442971-126442993 CCTATGATCCAGACCTCAAGAGA 0: 1
1: 1
2: 2
3: 25
4: 244
Right 1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG 0: 1
1: 0
2: 3
3: 25
4: 238
1104187059_1104187062 -5 Left 1104187059 12:126442979-126443001 CCAGACCTCAAGAGAGGGTTCCT 0: 1
1: 54
2: 746
3: 932
4: 754
Right 1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG 0: 1
1: 0
2: 3
3: 25
4: 238
1104187061_1104187062 -10 Left 1104187061 12:126442984-126443006 CCTCAAGAGAGGGTTCCTGGACC No data
Right 1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG 0: 1
1: 0
2: 3
3: 25
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187062 Original CRISPR TTCCTGGACCTCCCACAGAA AGG Intergenic
900315631 1:2054832-2054854 TTGCCGGACCTCCCACAAGAGGG + Intronic
902880902 1:19371186-19371208 TTCCACCACCTCCCACAGCAAGG - Intronic
906171449 1:43729326-43729348 TTCCTTGGCCTCCCAAAGTACGG + Intronic
907579561 1:55559340-55559362 TTCCTAGAGCACGCACAGAAGGG - Intergenic
909065598 1:70931718-70931740 TTCCTGGGCTGCCCACAGCATGG + Intronic
912000786 1:104832317-104832339 TTCCTGTACAGCCTACAGAATGG - Intergenic
912797808 1:112703453-112703475 TTTCTGGTTCTCCCACAGACTGG - Intronic
913471442 1:119191385-119191407 TTCTTGAATCTCACACAGAAAGG + Intergenic
914321127 1:146561381-146561403 TGCCTTGGCCTCCCAAAGAATGG - Intergenic
915165203 1:153944482-153944504 TTCCTAGTCCTTCCAAAGAAAGG + Intronic
915715561 1:157941439-157941461 TTCCTGGATATCCCACAGGCAGG - Intergenic
916660441 1:166918556-166918578 CTCCTGGACTTCCCACAGGTTGG - Exonic
918963709 1:191312373-191312395 TTCCTGTACAACCTACAGAATGG + Intergenic
922669212 1:227495951-227495973 TACCTGAATCTCCTACAGAAAGG + Intergenic
922670384 1:227505351-227505373 TACCTGAATCTCCTACAGAAAGG - Intergenic
922853544 1:228755163-228755185 TACCTGGACCTCCCTCAGACAGG - Intergenic
1062843045 10:686196-686218 TTCCTTGACCCTCCCCAGAATGG + Intronic
1063350661 10:5351841-5351863 TGCCTGTGCCTCCCACAGAAAGG - Intergenic
1063751085 10:8948076-8948098 TTCTTGGATCTCACACAAAAAGG - Intergenic
1065505361 10:26425186-26425208 TTCTTGGATCTCACACAAAAAGG - Intergenic
1069056622 10:63851041-63851063 TTCCAGGACCTTCGACTGAAGGG + Intergenic
1071083510 10:81840792-81840814 TTTCTGGACTCACCACAGAACGG + Intergenic
1071271355 10:84010424-84010446 TGCCTGGACCTCAGACAGCAGGG + Intergenic
1071396128 10:85225848-85225870 TTCCTGGATCGCCTGCAGAATGG - Intergenic
1072663681 10:97379227-97379249 GTCCTGGAACCTCCACAGAAGGG - Intronic
1074324684 10:112438117-112438139 ATTCTGTAACTCCCACAGAAAGG - Intronic
1075557313 10:123442954-123442976 CCCCTGGAGCTCCCACAGCATGG + Intergenic
1075795077 10:125114455-125114477 TTCCTGCACCTTCCACATATAGG + Intronic
1076981020 11:204844-204866 TTCCTGGAACTGACACAGGAAGG - Exonic
1077329846 11:1979412-1979434 GTCCTGCACGTCCCACAGACCGG - Intronic
1078983003 11:16559971-16559993 TTCTTGGCCCTCCCCCAAAATGG - Intronic
1080280978 11:30556123-30556145 TTCCCGGACTTTCCACTGAAAGG - Intronic
1080899986 11:36480610-36480632 TGCCTGGGCCTCCCAAAGTACGG + Intergenic
1081910849 11:46698882-46698904 TTCCTCACCCTCCCACTGAATGG - Intronic
1082731304 11:56801205-56801227 GTCCTTGACTTCCCACAGCATGG - Intergenic
1083485490 11:62980972-62980994 TTTCTGGGCCTACCACAGCATGG + Exonic
1083709933 11:64541638-64541660 TTCTTGGATCTCACACAGGAAGG + Intergenic
1084197488 11:67532267-67532289 TTCTTGGATCTCACACAGGAAGG - Intergenic
1085736679 11:79045236-79045258 TACCTGTGCCTCCCACAGAGAGG - Intronic
1085885514 11:80517427-80517449 TTCCTGTACAGCCCACAGAACGG + Intergenic
1087119661 11:94560291-94560313 TGCCTGCAGCTCACACAGAAGGG + Intronic
1088006611 11:104948703-104948725 CTGCTGTGCCTCCCACAGAATGG + Intronic
1089176226 11:116550837-116550859 CACCTGGATCTCCCACAGCAGGG - Intergenic
1089991792 11:122868506-122868528 TTTCTGGGCCCCCAACAGAATGG + Intronic
1090405729 11:126474930-126474952 TCCCTGGACAAGCCACAGAAGGG + Intronic
1091157436 11:133386759-133386781 TTCCTGGTCCCTTCACAGAAGGG + Intronic
1202812824 11_KI270721v1_random:34591-34613 GTCCTGCACGTCCCACAGACCGG - Intergenic
1091380001 12:51528-51550 TTCCTGCACATCCCACAGCATGG + Intergenic
1091410306 12:234871-234893 TTCTTGGACCTCTCACAAGAAGG - Intronic
1091431758 12:441808-441830 GTCACGGACCTCACACAGAAGGG - Exonic
1092210272 12:6641364-6641386 TGCCTGCTCCTCCCACATAACGG + Intronic
1092512401 12:9170788-9170810 TACCTGAAGCCCCCACAGAAAGG - Intronic
1093741886 12:22698624-22698646 TTCTTGGACCTCACACAAGAAGG + Intergenic
1096546028 12:52340870-52340892 TTCCTGGTCCTCTCACAGGTTGG + Intergenic
1096573964 12:52541072-52541094 TTCCAGTTACTCCCACAGAAAGG - Intergenic
1096603185 12:52745143-52745165 GTCCTGGGCCTCCCTCAGACAGG - Intergenic
1099264992 12:80434402-80434424 TTCCTTGGCTGCCCACAGAATGG - Intronic
1100215626 12:92445157-92445179 TTGCTTGACAACCCACAGAAAGG - Intergenic
1102231292 12:111264209-111264231 CTCCAGTACCTCCCCCAGAATGG + Intronic
1103888850 12:124223342-124223364 TTCCTGACCTTCCCACACAAAGG + Intronic
1104108637 12:125686356-125686378 TTCCAGCACCTTCCCCAGAAGGG - Intergenic
1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG + Intergenic
1104771825 12:131368669-131368691 TTCCAGGTCCTCCCCTAGAAGGG - Intergenic
1106947241 13:34842300-34842322 TTCCTGTACAGCCCACAGAACGG + Intergenic
1110281228 13:73696520-73696542 TTCCTGGATCTCATTCAGAATGG + Intronic
1111966581 13:94867706-94867728 TGCCTCAACCTCCCAAAGAAGGG - Intergenic
1111995928 13:95166242-95166264 TTCCAGGAACTCCCACACTAAGG - Exonic
1112370443 13:98788564-98788586 TCCCTGGACCCCCCGCAGACTGG + Intergenic
1114540028 14:23448372-23448394 TTCCTGTACAGCCTACAGAACGG - Intergenic
1115315882 14:32024480-32024502 TTCTTGGATCTCCCACAAGAAGG - Intergenic
1115462967 14:33682655-33682677 CCCCTGGAACTGCCACAGAAGGG + Intronic
1115668400 14:35580153-35580175 TTCCTGGACCCCCCAAAATAGGG - Intronic
1116447428 14:45026747-45026769 CGCCTGGGCCTCCCAAAGAATGG - Intronic
1116730457 14:48614916-48614938 TTCCTGTATCTTCCAGAGAAAGG - Intergenic
1117344017 14:54815344-54815366 TCCCTGGACCTCTCACTGGAAGG + Intergenic
1118898093 14:69963699-69963721 CACCTTGACCTCCCACAGGAAGG - Intronic
1119192939 14:72696563-72696585 CTCCTGGCCTTCCCACAAAATGG - Intronic
1119735744 14:76980666-76980688 TGCCTGGCCCTCCCATAGAGGGG + Intergenic
1124378409 15:29143474-29143496 TGCCCTGACCTCCCACAGGAAGG - Intronic
1125758346 15:42081131-42081153 TACCTGGACCACACACAGACAGG + Exonic
1127979789 15:64026129-64026151 TTCCAGGGCCTTCCACAGAGGGG - Intronic
1129930406 15:79405869-79405891 CTCCTGTCCTTCCCACAGAAAGG + Intronic
1132575809 16:663472-663494 TCCCTGCACCTCCCATAGACTGG + Intronic
1132899162 16:2244055-2244077 TCCCTGGCCTTCCCCCAGAAGGG + Intronic
1132988706 16:2781957-2781979 TTCTTGGATCTCACACAGGAAGG - Intergenic
1135567258 16:23520874-23520896 TTACTTGAACCCCCACAGAACGG - Intronic
1136032066 16:27510611-27510633 TCCCTTGACGTCCCTCAGAATGG - Intronic
1136222866 16:28839645-28839667 TTCCTCGGCCTCCCAAAGTATGG - Intergenic
1137393613 16:48101509-48101531 CTCCTGGAGCTTCCACATAAAGG - Intronic
1138546627 16:57723288-57723310 TTCCCTGACCTCCCACACATCGG - Intronic
1139015498 16:62684430-62684452 TTCCAGGCCCACCCGCAGAAGGG + Intergenic
1139430540 16:66908766-66908788 TCCATGGACCTCCAAGAGAAAGG + Intronic
1139650098 16:68357929-68357951 TCCCTGCACCTCCCTCAGATTGG + Exonic
1140232347 16:73127689-73127711 TTCCTGAACCTCACTCAGTAAGG + Intronic
1140543841 16:75787697-75787719 TTCCTGGAGCTCACACAGGATGG - Intergenic
1140830086 16:78742904-78742926 TTCCTGGGCCTCCCAAAAAGAGG + Intronic
1141999133 16:87654121-87654143 TTCGTGGACCGCCCAGAGGACGG - Intronic
1142354704 16:89596965-89596987 TTGCTGGCCCTCCCCCACAAAGG - Exonic
1142414971 16:89936366-89936388 TTCCCTGGCCTCCCACAGAGCGG + Intergenic
1142921558 17:3191822-3191844 TTCTTGGATCTCACACAGGATGG - Intergenic
1144789372 17:17848855-17848877 TCTCTGCTCCTCCCACAGAAGGG - Exonic
1146457295 17:33017801-33017823 GGCCTGGACCTCCCACAACAAGG - Intronic
1146761107 17:35479857-35479879 TTCCTGGACTTCATGCAGAATGG - Exonic
1146951566 17:36910209-36910231 TGCATGGGCTTCCCACAGAAGGG - Intergenic
1147838477 17:43352738-43352760 TTCCTAGCCCTCCCTCAAAATGG + Intergenic
1149622707 17:58058161-58058183 TACCTGGATTTCCTACAGAAAGG - Intergenic
1153718333 18:7874820-7874842 ATCCTATAGCTCCCACAGAAAGG + Intronic
1156598071 18:38570808-38570830 TTCCCTGACCTGTCACAGAATGG - Intergenic
1158940098 18:62399819-62399841 TTTCTTGTCCTCCCACAGGAAGG - Intergenic
1159220941 18:65462364-65462386 TCTCTGGAGTTCCCACAGAAAGG + Intergenic
1159421904 18:68232737-68232759 TTGCTGTACTTCCCACAGAAAGG + Intergenic
1159641635 18:70869990-70870012 TTCCAGGACCTCCCACAGATAGG + Intergenic
1162458063 19:10797772-10797794 TTCCTGGAACCCCTAGAGAAAGG + Intronic
1162621972 19:11850670-11850692 TTCTTGGATCTCACACAGGAAGG + Intronic
1162635906 19:11966975-11966997 TTCTTGGATCTCACACAGGAAGG + Intronic
1163853080 19:19677627-19677649 TCCCTGGACCCACCACAGAGAGG + Intronic
1163969697 19:20780252-20780274 TTCCTGGAGCACACAAAGAATGG + Intronic
1165332656 19:35149728-35149750 CTCCTGGACCTTCCACTCAATGG + Intronic
1167715121 19:51138111-51138133 ATCCTGGAGCTGCCCCAGAAAGG + Intergenic
1168489580 19:56796774-56796796 TTCTTGGATCTCACACAGGAAGG + Intronic
925670800 2:6308022-6308044 TTCCTTGTCCTCCCAAAGCATGG - Intergenic
925679801 2:6408685-6408707 GTCCTGGAGATTCCACAGAAGGG - Intergenic
925717856 2:6801573-6801595 TTCCTGGACCTCAGTCAGCATGG - Intergenic
925926702 2:8676329-8676351 GTCCTGCCCCTCCCGCAGAATGG + Intergenic
926129789 2:10295582-10295604 TTCTTGGACCTCGCACAAGAAGG + Intergenic
926931966 2:18049699-18049721 TTCATCGAGCTCCCACAGCATGG - Intronic
928247041 2:29639378-29639400 TGCCAGGACCACCCACAGATAGG + Intronic
929422202 2:41803796-41803818 TTCTTGGATCCCTCACAGAATGG - Intergenic
930483051 2:51973560-51973582 TTCCTGTACAGCCTACAGAACGG - Intergenic
931137636 2:59421919-59421941 TTCCTGGAATTGCCACAGACAGG - Intergenic
932421071 2:71601721-71601743 TTCTTGGACTTCGCAGAGAAGGG - Intronic
934863728 2:97787528-97787550 TTCCTGGACCTCCCATTGTCTGG + Intronic
935108507 2:100069322-100069344 TTCCTGGACCCCCCTCTGGAGGG - Intronic
936563872 2:113567314-113567336 TTCCTGCACATCCCACAGCATGG - Intergenic
936691342 2:114892847-114892869 GTCCTGGACCCCCCAAAAAATGG + Intronic
937251077 2:120524216-120524238 ATCCTCCACCTCCCACAGCATGG - Intergenic
937268894 2:120634595-120634617 TTCCTGGGCCTCTCAGAGAATGG + Intergenic
937773071 2:125744954-125744976 TGCCAGGACCTTCCTCAGAAAGG + Intergenic
941127009 2:161596050-161596072 TTCCTGATCTTCCCTCAGAAAGG - Intronic
948282434 2:236757647-236757669 TGCCTGGACCTTCCCCAGGATGG + Intergenic
948444745 2:238023753-238023775 CTCCAGGACCTCCCACAGAAAGG - Intronic
1168825912 20:813784-813806 TTTCTGGACCTCACACAAGAAGG - Intergenic
1169078042 20:2774179-2774201 TTCCTTGACCTCCCAAAGTTTGG + Intergenic
1169521762 20:6381285-6381307 TTTCTGGACCTCACTCATAATGG + Intergenic
1169957356 20:11119387-11119409 GTCCTGGACCTACCTCAGAAAGG + Intergenic
1171350014 20:24494833-24494855 TTTCTGGGCCTCCCTCAGAGGGG - Intronic
1171983054 20:31640441-31640463 TTGGTGGACCTCCCAGAGGAGGG + Intronic
1173076684 20:39825927-39825949 TTCTTGGAGCTTCCACACAAAGG + Intergenic
1174410476 20:50331741-50331763 TTCTTAGACCTCCCACCCAATGG - Intergenic
1176299003 21:5089846-5089868 TTCTTGGACCTCACACAGGAAGG - Intergenic
1177228800 21:18292372-18292394 TTCTTGGATCTCACACAGGAAGG - Intronic
1177784149 21:25652135-25652157 TGCCTGGGCCTCCCAAAGTATGG - Intronic
1178349690 21:31863862-31863884 CTCCTGGACATCCTGCAGAACGG + Intergenic
1178361068 21:31948880-31948902 TTCCTGGAACTTTCCCAGAAGGG + Intronic
1179799445 21:43804052-43804074 TTTCTGAACCCCCCACAGCAGGG - Exonic
1179858023 21:44172103-44172125 TTCTTGGACCTCACACAGGAAGG + Intergenic
1180163592 21:46008999-46009021 TTCCTGGACCATCCACAGCATGG + Intergenic
1181436247 22:22912860-22912882 TCCCGGGACCTCCCACAGTCGGG + Intergenic
1181842914 22:25680216-25680238 TGCCTTGACCTCCCACTGTATGG + Intronic
1182777233 22:32839997-32840019 GTCCTGGACCTCCCGGGGAAGGG - Intronic
1183084676 22:35479337-35479359 TTCCTTGGCCTCCCAAAGTATGG + Intergenic
1183307125 22:37088546-37088568 AGCCTGGTCCTCCCACAGGATGG - Intronic
1184188888 22:42881828-42881850 TTCCTGGCCATCCCACAGGGTGG + Intronic
1185354663 22:50360610-50360632 TGCCTGGACCTCCCAAAGCATGG + Intronic
1185390387 22:50557914-50557936 TTCCTGGGCCTCCCTCATCACGG + Intronic
949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG + Intronic
950996228 3:17499911-17499933 TTCCTGGACCCCCCAGACATGGG - Intronic
954614139 3:51960894-51960916 GTTTTGTACCTCCCACAGAAGGG - Exonic
955776581 3:62440268-62440290 TTACTGGATCTCCCACAAATTGG + Intronic
956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG + Intronic
960960042 3:123064379-123064401 TTCCAGGACCTAGCACAGGACGG - Intergenic
961643779 3:128381637-128381659 TTCCTGGAGCTTCCACAGAAGGG + Intronic
961706981 3:128794643-128794665 TTCCAGGACTTGCCACAGCATGG - Intronic
962153549 3:132919114-132919136 TCCCTCGACAACCCACAGAATGG + Intergenic
962489844 3:135882611-135882633 TTTCTGCATCTCCCACAGAGTGG - Intergenic
964422102 3:156513894-156513916 GAGCTGGACCTCACACAGAATGG - Intronic
968283599 3:197495203-197495225 TTCTTGGGCCTCCGACTGAAAGG - Intergenic
968561376 4:1284852-1284874 CTCCTGGCCCACCCACACAAGGG + Intergenic
969290418 4:6235520-6235542 CTGCTGGACTCCCCACAGAAAGG - Intergenic
970322948 4:14893611-14893633 TTCCTTGATGTCCCACAGTATGG + Intergenic
970567366 4:17345877-17345899 TGCCTCGGCCTCCCAAAGAAGGG - Intergenic
970882190 4:20945320-20945342 TTCCAGAACATCCCACAGCAGGG + Intronic
971631597 4:28999440-28999462 TTCAATTACCTCCCACAGAAGGG - Intergenic
975183441 4:71373624-71373646 TTCATAGACCTTCCACAAAATGG - Intronic
976508357 4:85877374-85877396 TGCCTGGGCCTCCCAAAGTATGG - Intronic
977262965 4:94820121-94820143 TTCCTGTACCTCACACAGTGAGG + Intronic
977447091 4:97144576-97144598 TTCTTGGAGGTCCCACAGAAAGG + Intergenic
977674184 4:99730218-99730240 TTCCTGGATCCCCCAAAGGAGGG + Intergenic
982435711 4:155382250-155382272 TTCCTGCACCGCCCTCAGAAGGG + Intergenic
983131285 4:164022852-164022874 TGCCTGGCCACCCCACAGAAAGG + Intronic
985487353 5:158894-158916 TTCCAGGACTTCCCAGAGAAAGG + Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986255660 5:6100661-6100683 TCCATGGACCTCCCACCAAATGG + Intergenic
986256069 5:6101845-6101867 TCCCTGGACCTCCCACCACATGG + Intergenic
987004113 5:13691984-13692006 TTACTTGACATCACACAGAAGGG + Exonic
991420333 5:66434632-66434654 TGCCTGGACCTCCCAAAGTGTGG + Intergenic
992253184 5:74896031-74896053 CTCCAGGACCTCCCACATATGGG - Intergenic
993476101 5:88366572-88366594 TTCTTGGATCTCACACAGAAAGG - Intergenic
993568518 5:89506362-89506384 TTCCTGGAACTCACATACAAGGG + Intergenic
995258276 5:110072583-110072605 TTGCTGAAATTCCCACAGAAAGG + Intergenic
997284265 5:132667353-132667375 TTCTTGGATCTCGCACAGGAAGG - Intergenic
998729960 5:145063548-145063570 TACCTGGAGCTCCCAAACAAAGG - Intergenic
1000677351 5:164137522-164137544 ATCCTGGATCTTCCAAAGAAAGG - Intergenic
1000922232 5:167151868-167151890 TTTATTGACCTCCCACAGCATGG - Intergenic
1001111337 5:168898875-168898897 TCCCTGGTACACCCACAGAAAGG + Intronic
1001168815 5:169397009-169397031 TGCCTTGGCCTCACACAGAATGG + Intergenic
1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG + Intergenic
1001930382 5:175668715-175668737 TTCCTGGACAGCCTGCAGAATGG - Intronic
1002070609 5:176677100-176677122 TTCATGGACCTGCCCCAGAGAGG + Intergenic
1002882156 6:1262838-1262860 TCCCTGGACCTGCCAGGGAACGG + Intergenic
1007257444 6:40538763-40538785 GTCCTGGACCTGACACACAACGG - Intronic
1008591686 6:52999853-52999875 TTCTTGGATCTCGCACAGGAAGG - Intergenic
1011390991 6:86853232-86853254 CTCCTAGACCTGCAACAGAATGG + Intergenic
1014007223 6:116433479-116433501 TTCCTGGACCTTCCACCACACGG - Exonic
1016061591 6:139636493-139636515 TTCCTGTAGCTCCCACAGCTGGG + Intergenic
1016668493 6:146672583-146672605 TTCTTGGATCTCACACAGTAGGG + Intronic
1017864914 6:158434958-158434980 TTCTTGGAGCTCCCCCAGACTGG - Intronic
1017993641 6:159511453-159511475 TTCCTGGATCTCGCACAAGAAGG + Intergenic
1018036334 6:159885325-159885347 CACCTCGACCTCCCACAGTATGG + Intergenic
1018658493 6:166063531-166063553 TTCCTGTACAGCCTACAGAACGG + Intergenic
1019002101 6:168763044-168763066 TTCCTGTACATCCTACAGAAGGG - Intergenic
1019311961 7:367229-367251 TTCCTGGACCTCACCCAGCCAGG + Intergenic
1025921026 7:65913475-65913497 TGCCTCGACCTCCCAAAGTATGG - Intronic
1028120786 7:87054575-87054597 TTCAGGGACTTCCTACAGAAAGG + Intronic
1029270142 7:99372707-99372729 TTCCTGCAGCTCGCTCAGAAGGG + Intronic
1029422815 7:100479770-100479792 TTCCTCGACCTCCCAAAGTGCGG - Intergenic
1029611797 7:101630539-101630561 CGCCTGGACCTGCTACAGAAGGG + Intergenic
1032665197 7:134029192-134029214 TTCTTGGAACTCCCACAGTGAGG - Intronic
1033936623 7:146593352-146593374 TTCCTGGAGCTCCCACTAAGGGG + Intronic
1034217320 7:149418259-149418281 TTCCTGGATCACCCACCTAAGGG + Intergenic
1035525732 8:311618-311640 TTTCTCCACCACCCACAGAAAGG - Intergenic
1036104591 8:5826170-5826192 TTCCTGGACTTTCAAAAGAAAGG + Intergenic
1036667032 8:10753041-10753063 TTCTTGGACATCCCACAGATAGG + Intronic
1039116014 8:34091932-34091954 TTCCTGGCCCTCACTCAAAATGG - Intergenic
1040668570 8:49659114-49659136 TTCCTGCAGCACACACAGAATGG + Intergenic
1041243828 8:55872399-55872421 TTCCTTGAAATCCCACAGAAAGG - Intergenic
1046181617 8:110656213-110656235 TTCCTGCACCCCCAACAGAGTGG + Intergenic
1047437765 8:124848963-124848985 CTCCTGGACCTCCCAGGAAAAGG - Intergenic
1049064395 8:140301593-140301615 CTCCTGGACGTCAGACAGAAAGG + Intronic
1049888657 9:46807-46829 TTCCTGCACATCCCACAGCATGG + Intergenic
1050258304 9:3815883-3815905 TTCCTGCCCCTCCCCCAGAAAGG + Intergenic
1053362836 9:37501532-37501554 TTCCTGGGCCTCACACACAGTGG - Intronic
1056337230 9:85584418-85584440 TTCCAGTAGCTTCCACAGAAAGG + Intronic
1056859884 9:90171147-90171169 TTCCTGGAACAGCCAGAGAATGG - Intergenic
1057008150 9:91578771-91578793 ATCCTGGAACTCCCACAGGGTGG + Intronic
1057066386 9:92056105-92056127 TTCCTTCACCTCCCAAAAAAAGG + Intronic
1059022455 9:110591534-110591556 TTCTTGGATCTCACACAGGAAGG - Intergenic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1060003512 9:119979787-119979809 TTCCTTGACATCACACAGCAGGG - Intergenic
1060202677 9:121660928-121660950 TTCCTGGAATTCTCACAGGATGG + Intronic
1060482545 9:124025534-124025556 TCCCTGGCCCTTCCACAGGAAGG - Intronic
1060661183 9:125406101-125406123 TTCCTGGAGGTCACACAGCAGGG + Intergenic
1061951369 9:133938203-133938225 TTCCTGGACCACCGGGAGAATGG - Intronic
1062374267 9:136254926-136254948 TTTCTGGAACTCCCAGAGAGAGG + Intergenic
1062440965 9:136569048-136569070 TTCCTGGGCCTCCAGCAGGAGGG - Intergenic
1062626098 9:137441985-137442007 TTCTTGGATCTCACACAGAAAGG - Intergenic
1186935841 X:14449622-14449644 TGCCTGGGTCTCCCACAGGAGGG + Intergenic
1187040752 X:15593191-15593213 TTCCTGTACTTATCACAGAATGG - Intronic
1188465884 X:30480512-30480534 TTCCTGCACATGCCTCAGAAAGG - Intergenic
1189086123 X:38026446-38026468 TTCCTGGATCTCACACAAGAAGG + Intronic
1194368599 X:93040949-93040971 TTCCTGGTCCTCACTCAAAACGG + Intergenic
1196000900 X:110784658-110784680 TGCCTGGGCCTCCCACAGCATGG + Intronic
1197329649 X:125138025-125138047 TTTCTGGACTTTACACAGAAAGG - Intergenic
1197837466 X:130710857-130710879 TACCTGGACTTCCCACAACAAGG - Intronic
1198311317 X:135427280-135427302 CTTCTGGACCTCACCCAGAAAGG - Intergenic
1198405044 X:136303937-136303959 TTACTTGTCCTCCCACAGAGAGG - Intronic
1200676798 Y:6157238-6157260 TTCCTGGTCCTCACTCAAAATGG + Intergenic