ID: 1104187197

View in Genome Browser
Species Human (GRCh38)
Location 12:126444239-126444261
Sequence CGCTGAAACCTAGGAGGTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187197_1104187202 17 Left 1104187197 12:126444239-126444261 CCGCTACCTCCTAGGTTTCAGCG No data
Right 1104187202 12:126444279-126444301 TCCCGAGTAGGTGAGATTATAGG No data
1104187197_1104187200 5 Left 1104187197 12:126444239-126444261 CCGCTACCTCCTAGGTTTCAGCG No data
Right 1104187200 12:126444267-126444289 CATGCCTCAGACTCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187197 Original CRISPR CGCTGAAACCTAGGAGGTAG CGG (reversed) Intergenic