ID: 1104187198 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:126444245-126444267 |
Sequence | GAGAATCGCTGAAACCTAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104187198_1104187202 | 11 | Left | 1104187198 | 12:126444245-126444267 | CCTCCTAGGTTTCAGCGATTCTC | No data | ||
Right | 1104187202 | 12:126444279-126444301 | TCCCGAGTAGGTGAGATTATAGG | No data | ||||
1104187198_1104187205 | 30 | Left | 1104187198 | 12:126444245-126444267 | CCTCCTAGGTTTCAGCGATTCTC | No data | ||
Right | 1104187205 | 12:126444298-126444320 | TAGGCGCCCACCATCACGCCTGG | No data | ||||
1104187198_1104187200 | -1 | Left | 1104187198 | 12:126444245-126444267 | CCTCCTAGGTTTCAGCGATTCTC | No data | ||
Right | 1104187200 | 12:126444267-126444289 | CATGCCTCAGACTCCCGAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104187198 | Original CRISPR | GAGAATCGCTGAAACCTAGG AGG (reversed) | Intergenic | ||