ID: 1104187198

View in Genome Browser
Species Human (GRCh38)
Location 12:126444245-126444267
Sequence GAGAATCGCTGAAACCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187198_1104187202 11 Left 1104187198 12:126444245-126444267 CCTCCTAGGTTTCAGCGATTCTC No data
Right 1104187202 12:126444279-126444301 TCCCGAGTAGGTGAGATTATAGG No data
1104187198_1104187200 -1 Left 1104187198 12:126444245-126444267 CCTCCTAGGTTTCAGCGATTCTC No data
Right 1104187200 12:126444267-126444289 CATGCCTCAGACTCCCGAGTAGG No data
1104187198_1104187205 30 Left 1104187198 12:126444245-126444267 CCTCCTAGGTTTCAGCGATTCTC No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187198 Original CRISPR GAGAATCGCTGAAACCTAGG AGG (reversed) Intergenic
No off target data available for this crispr