ID: 1104187199

View in Genome Browser
Species Human (GRCh38)
Location 12:126444248-126444270
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187199_1104187202 8 Left 1104187199 12:126444248-126444270 CCTAGGTTTCAGCGATTCTCATG No data
Right 1104187202 12:126444279-126444301 TCCCGAGTAGGTGAGATTATAGG No data
1104187199_1104187200 -4 Left 1104187199 12:126444248-126444270 CCTAGGTTTCAGCGATTCTCATG No data
Right 1104187200 12:126444267-126444289 CATGCCTCAGACTCCCGAGTAGG No data
1104187199_1104187205 27 Left 1104187199 12:126444248-126444270 CCTAGGTTTCAGCGATTCTCATG No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187199 Original CRISPR CATGAGAATCGCTGAAACCT AGG (reversed) Intergenic