ID: 1104187200

View in Genome Browser
Species Human (GRCh38)
Location 12:126444267-126444289
Sequence CATGCCTCAGACTCCCGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187199_1104187200 -4 Left 1104187199 12:126444248-126444270 CCTAGGTTTCAGCGATTCTCATG No data
Right 1104187200 12:126444267-126444289 CATGCCTCAGACTCCCGAGTAGG No data
1104187198_1104187200 -1 Left 1104187198 12:126444245-126444267 CCTCCTAGGTTTCAGCGATTCTC No data
Right 1104187200 12:126444267-126444289 CATGCCTCAGACTCCCGAGTAGG No data
1104187197_1104187200 5 Left 1104187197 12:126444239-126444261 CCGCTACCTCCTAGGTTTCAGCG No data
Right 1104187200 12:126444267-126444289 CATGCCTCAGACTCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187200 Original CRISPR CATGCCTCAGACTCCCGAGT AGG Intergenic
No off target data available for this crispr