ID: 1104187202

View in Genome Browser
Species Human (GRCh38)
Location 12:126444279-126444301
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187197_1104187202 17 Left 1104187197 12:126444239-126444261 CCGCTACCTCCTAGGTTTCAGCG No data
Right 1104187202 12:126444279-126444301 TCCCGAGTAGGTGAGATTATAGG No data
1104187198_1104187202 11 Left 1104187198 12:126444245-126444267 CCTCCTAGGTTTCAGCGATTCTC No data
Right 1104187202 12:126444279-126444301 TCCCGAGTAGGTGAGATTATAGG No data
1104187199_1104187202 8 Left 1104187199 12:126444248-126444270 CCTAGGTTTCAGCGATTCTCATG No data
Right 1104187202 12:126444279-126444301 TCCCGAGTAGGTGAGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187202 Original CRISPR TCCCGAGTAGGTGAGATTAT AGG Intergenic
No off target data available for this crispr