ID: 1104187205

View in Genome Browser
Species Human (GRCh38)
Location 12:126444298-126444320
Sequence TAGGCGCCCACCATCACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187199_1104187205 27 Left 1104187199 12:126444248-126444270 CCTAGGTTTCAGCGATTCTCATG No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data
1104187203_1104187205 -5 Left 1104187203 12:126444280-126444302 CCCGAGTAGGTGAGATTATAGGC No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data
1104187204_1104187205 -6 Left 1104187204 12:126444281-126444303 CCGAGTAGGTGAGATTATAGGCG No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data
1104187198_1104187205 30 Left 1104187198 12:126444245-126444267 CCTCCTAGGTTTCAGCGATTCTC No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data
1104187201_1104187205 4 Left 1104187201 12:126444271-126444293 CCTCAGACTCCCGAGTAGGTGAG No data
Right 1104187205 12:126444298-126444320 TAGGCGCCCACCATCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187205 Original CRISPR TAGGCGCCCACCATCACGCC TGG Intergenic
No off target data available for this crispr