ID: 1104187869

View in Genome Browser
Species Human (GRCh38)
Location 12:126449674-126449696
Sequence CGGCCAGCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104187862_1104187869 23 Left 1104187862 12:126449628-126449650 CCTGCTGGATCTGGAGGGATGGA No data
Right 1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG No data
1104187860_1104187869 24 Left 1104187860 12:126449627-126449649 CCCTGCTGGATCTGGAGGGATGG No data
Right 1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104187869 Original CRISPR CGGCCAGCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr