ID: 1104190286

View in Genome Browser
Species Human (GRCh38)
Location 12:126475607-126475629
Sequence CTTTATTAGCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104190286_1104190287 -7 Left 1104190286 12:126475607-126475629 CCATTCTCATTCTGCTAATAAAG No data
Right 1104190287 12:126475623-126475645 AATAAAGACACACCCAAGACTGG 0: 47
1: 1029
2: 3133
3: 5526
4: 7858
1104190286_1104190288 -6 Left 1104190286 12:126475607-126475629 CCATTCTCATTCTGCTAATAAAG No data
Right 1104190288 12:126475624-126475646 ATAAAGACACACCCAAGACTGGG 0: 118
1: 2379
2: 4304
3: 7473
4: 8903
1104190286_1104190291 7 Left 1104190286 12:126475607-126475629 CCATTCTCATTCTGCTAATAAAG No data
Right 1104190291 12:126475637-126475659 CAAGACTGGGTAATTTATACAGG 0: 58
1: 1507
2: 2627
3: 4203
4: 3676
1104190286_1104190292 14 Left 1104190286 12:126475607-126475629 CCATTCTCATTCTGCTAATAAAG No data
Right 1104190292 12:126475644-126475666 GGGTAATTTATACAGGAAAGAGG 0: 52
1: 3708
2: 8317
3: 8914
4: 8344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104190286 Original CRISPR CTTTATTAGCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr