ID: 1104197378

View in Genome Browser
Species Human (GRCh38)
Location 12:126554030-126554052
Sequence GTTTTTAAGGATATTTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104197372_1104197378 -1 Left 1104197372 12:126554008-126554030 CCCAGAAAATCCGGGGGTCAGAG No data
Right 1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG No data
1104197367_1104197378 11 Left 1104197367 12:126553996-126554018 CCAAATCAGTCTCCCAGAAAATC No data
Right 1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG No data
1104197373_1104197378 -2 Left 1104197373 12:126554009-126554031 CCAGAAAATCCGGGGGTCAGAGT No data
Right 1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104197378 Original CRISPR GTTTTTAAGGATATTTTGGT GGG Intergenic
No off target data available for this crispr