ID: 1104197863

View in Genome Browser
Species Human (GRCh38)
Location 12:126558401-126558423
Sequence CTGATTCTGCACAAGCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104197863_1104197869 16 Left 1104197863 12:126558401-126558423 CCTGATGGCTTGTGCAGAATCAG No data
Right 1104197869 12:126558440-126558462 GAACAGGTTTGGTTCAAACTTGG No data
1104197863_1104197868 5 Left 1104197863 12:126558401-126558423 CCTGATGGCTTGTGCAGAATCAG No data
Right 1104197868 12:126558429-126558451 AAGCAGGTGTGGAACAGGTTTGG No data
1104197863_1104197866 -6 Left 1104197863 12:126558401-126558423 CCTGATGGCTTGTGCAGAATCAG No data
Right 1104197866 12:126558418-126558440 AATCAGGTTACAAGCAGGTGTGG No data
1104197863_1104197870 22 Left 1104197863 12:126558401-126558423 CCTGATGGCTTGTGCAGAATCAG No data
Right 1104197870 12:126558446-126558468 GTTTGGTTCAAACTTGGCCTTGG No data
1104197863_1104197867 0 Left 1104197863 12:126558401-126558423 CCTGATGGCTTGTGCAGAATCAG No data
Right 1104197867 12:126558424-126558446 GTTACAAGCAGGTGTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104197863 Original CRISPR CTGATTCTGCACAAGCCATC AGG (reversed) Intergenic
No off target data available for this crispr