ID: 1104198741

View in Genome Browser
Species Human (GRCh38)
Location 12:126567137-126567159
Sequence CACTTGGAGCAGCCGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104198737_1104198741 -2 Left 1104198737 12:126567116-126567138 CCGGGTGGGCATGAGCTCCTGCA No data
Right 1104198741 12:126567137-126567159 CACTTGGAGCAGCCGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104198741 Original CRISPR CACTTGGAGCAGCCGGCCCC AGG Intergenic
No off target data available for this crispr