ID: 1104202277

View in Genome Browser
Species Human (GRCh38)
Location 12:126601268-126601290
Sequence TGGGCTGGCCAAAATACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104202277_1104202285 17 Left 1104202277 12:126601268-126601290 CCTGGTGTATTTTGGCCAGCCCA No data
Right 1104202285 12:126601308-126601330 TCTCTCTCTGTATCATTCGCTGG No data
1104202277_1104202286 30 Left 1104202277 12:126601268-126601290 CCTGGTGTATTTTGGCCAGCCCA No data
Right 1104202286 12:126601321-126601343 CATTCGCTGGTTAGTAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104202277 Original CRISPR TGGGCTGGCCAAAATACACC AGG (reversed) Intergenic
No off target data available for this crispr