ID: 1104202886

View in Genome Browser
Species Human (GRCh38)
Location 12:126609120-126609142
Sequence AAAAACAGTGTGAGGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104202886_1104202891 7 Left 1104202886 12:126609120-126609142 CCAGCAGGCCTCACACTGTTTTT No data
Right 1104202891 12:126609150-126609172 GTGGTGATGAGCAGGCCCAAAGG No data
1104202886_1104202890 -1 Left 1104202886 12:126609120-126609142 CCAGCAGGCCTCACACTGTTTTT No data
Right 1104202890 12:126609142-126609164 TTGGAGCTGTGGTGATGAGCAGG No data
1104202886_1104202892 21 Left 1104202886 12:126609120-126609142 CCAGCAGGCCTCACACTGTTTTT No data
Right 1104202892 12:126609164-126609186 GCCCAAAGGCCTGACACCCCCGG No data
1104202886_1104202896 29 Left 1104202886 12:126609120-126609142 CCAGCAGGCCTCACACTGTTTTT No data
Right 1104202896 12:126609172-126609194 GCCTGACACCCCCGGCATCTGGG No data
1104202886_1104202895 28 Left 1104202886 12:126609120-126609142 CCAGCAGGCCTCACACTGTTTTT No data
Right 1104202895 12:126609171-126609193 GGCCTGACACCCCCGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104202886 Original CRISPR AAAAACAGTGTGAGGCCTGC TGG (reversed) Intergenic
No off target data available for this crispr