ID: 1104203537

View in Genome Browser
Species Human (GRCh38)
Location 12:126615057-126615079
Sequence TTGGGAGATATGTTCTCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104203537_1104203545 12 Left 1104203537 12:126615057-126615079 CCCATTGAGAACATATCTCCCAA No data
Right 1104203545 12:126615092-126615114 TGATACCCCCGCGATGAGCAAGG No data
1104203537_1104203549 18 Left 1104203537 12:126615057-126615079 CCCATTGAGAACATATCTCCCAA No data
Right 1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG No data
1104203537_1104203551 19 Left 1104203537 12:126615057-126615079 CCCATTGAGAACATATCTCCCAA No data
Right 1104203551 12:126615099-126615121 CCCGCGATGAGCAAGGCGTGGGG No data
1104203537_1104203553 26 Left 1104203537 12:126615057-126615079 CCCATTGAGAACATATCTCCCAA No data
Right 1104203553 12:126615106-126615128 TGAGCAAGGCGTGGGGTCAGTGG No data
1104203537_1104203547 17 Left 1104203537 12:126615057-126615079 CCCATTGAGAACATATCTCCCAA No data
Right 1104203547 12:126615097-126615119 CCCCCGCGATGAGCAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104203537 Original CRISPR TTGGGAGATATGTTCTCAAT GGG (reversed) Intergenic