ID: 1104203542

View in Genome Browser
Species Human (GRCh38)
Location 12:126615075-126615097
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104203542_1104203553 8 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203553 12:126615106-126615128 TGAGCAAGGCGTGGGGTCAGTGG No data
1104203542_1104203547 -1 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203547 12:126615097-126615119 CCCCCGCGATGAGCAAGGCGTGG No data
1104203542_1104203551 1 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203551 12:126615099-126615121 CCCGCGATGAGCAAGGCGTGGGG No data
1104203542_1104203554 20 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203554 12:126615118-126615140 GGGGTCAGTGGCTTCTCTGAAGG No data
1104203542_1104203556 22 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203556 12:126615120-126615142 GGTCAGTGGCTTCTCTGAAGGGG No data
1104203542_1104203545 -6 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203545 12:126615092-126615114 TGATACCCCCGCGATGAGCAAGG No data
1104203542_1104203555 21 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203555 12:126615119-126615141 GGGTCAGTGGCTTCTCTGAAGGG No data
1104203542_1104203557 28 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203557 12:126615126-126615148 TGGCTTCTCTGAAGGGGCAGAGG No data
1104203542_1104203549 0 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104203542 Original CRISPR GTATCAAGGCACCCCAAGTT GGG (reversed) Intergenic