ID: 1104203547

View in Genome Browser
Species Human (GRCh38)
Location 12:126615097-126615119
Sequence CCCCCGCGATGAGCAAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104203542_1104203547 -1 Left 1104203542 12:126615075-126615097 CCCAACTTGGGGTGCCTTGATAC No data
Right 1104203547 12:126615097-126615119 CCCCCGCGATGAGCAAGGCGTGG No data
1104203537_1104203547 17 Left 1104203537 12:126615057-126615079 CCCATTGAGAACATATCTCCCAA No data
Right 1104203547 12:126615097-126615119 CCCCCGCGATGAGCAAGGCGTGG No data
1104203538_1104203547 16 Left 1104203538 12:126615058-126615080 CCATTGAGAACATATCTCCCAAC No data
Right 1104203547 12:126615097-126615119 CCCCCGCGATGAGCAAGGCGTGG No data
1104203543_1104203547 -2 Left 1104203543 12:126615076-126615098 CCAACTTGGGGTGCCTTGATACC No data
Right 1104203547 12:126615097-126615119 CCCCCGCGATGAGCAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104203547 Original CRISPR CCCCCGCGATGAGCAAGGCG TGG Intergenic
No off target data available for this crispr