ID: 1104203549 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:126615098-126615120 |
| Sequence | CCCCGCGATGAGCAAGGCGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104203537_1104203549 | 18 | Left | 1104203537 | 12:126615057-126615079 | CCCATTGAGAACATATCTCCCAA | No data | ||
| Right | 1104203549 | 12:126615098-126615120 | CCCCGCGATGAGCAAGGCGTGGG | No data | ||||
| 1104203542_1104203549 | 0 | Left | 1104203542 | 12:126615075-126615097 | CCCAACTTGGGGTGCCTTGATAC | No data | ||
| Right | 1104203549 | 12:126615098-126615120 | CCCCGCGATGAGCAAGGCGTGGG | No data | ||||
| 1104203538_1104203549 | 17 | Left | 1104203538 | 12:126615058-126615080 | CCATTGAGAACATATCTCCCAAC | No data | ||
| Right | 1104203549 | 12:126615098-126615120 | CCCCGCGATGAGCAAGGCGTGGG | No data | ||||
| 1104203543_1104203549 | -1 | Left | 1104203543 | 12:126615076-126615098 | CCAACTTGGGGTGCCTTGATACC | No data | ||
| Right | 1104203549 | 12:126615098-126615120 | CCCCGCGATGAGCAAGGCGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104203549 | Original CRISPR | CCCCGCGATGAGCAAGGCGT GGG | Intergenic | ||
| No off target data available for this crispr | |||||