ID: 1104204357

View in Genome Browser
Species Human (GRCh38)
Location 12:126622976-126622998
Sequence TTCCCATGGGGTAGGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104204357_1104204365 21 Left 1104204357 12:126622976-126622998 CCTGCACACCTACCCCATGGGAA No data
Right 1104204365 12:126623020-126623042 ACACGGAGCTGTCATTTCCCAGG No data
1104204357_1104204364 4 Left 1104204357 12:126622976-126622998 CCTGCACACCTACCCCATGGGAA No data
Right 1104204364 12:126623003-126623025 TTCACAGACAGTAACACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104204357 Original CRISPR TTCCCATGGGGTAGGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr