ID: 1104207446

View in Genome Browser
Species Human (GRCh38)
Location 12:126653479-126653501
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104207446_1104207453 17 Left 1104207446 12:126653479-126653501 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1104207453 12:126653519-126653541 CCTCAGCCTCCCAAGTAGACAGG 0: 19
1: 1861
2: 101800
3: 212566
4: 252831
1104207446_1104207455 25 Left 1104207446 12:126653479-126653501 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1104207455 12:126653527-126653549 TCCCAAGTAGACAGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104207446 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intergenic
Too many off-targets to display for this crispr