ID: 1104208195

View in Genome Browser
Species Human (GRCh38)
Location 12:126661012-126661034
Sequence TCTGGGGAACTGTAATGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104208195_1104208198 -6 Left 1104208195 12:126661012-126661034 CCTCTGCATTACAGTTCCCCAGA No data
Right 1104208198 12:126661029-126661051 CCCAGAGAAATAGAACCAATAGG No data
1104208195_1104208202 20 Left 1104208195 12:126661012-126661034 CCTCTGCATTACAGTTCCCCAGA No data
Right 1104208202 12:126661055-126661077 TAGATAGATAGGCAGATAGATGG No data
1104208195_1104208204 28 Left 1104208195 12:126661012-126661034 CCTCTGCATTACAGTTCCCCAGA No data
Right 1104208204 12:126661063-126661085 TAGGCAGATAGATGGATGGATGG No data
1104208195_1104208203 24 Left 1104208195 12:126661012-126661034 CCTCTGCATTACAGTTCCCCAGA No data
Right 1104208203 12:126661059-126661081 TAGATAGGCAGATAGATGGATGG No data
1104208195_1104208201 9 Left 1104208195 12:126661012-126661034 CCTCTGCATTACAGTTCCCCAGA No data
Right 1104208201 12:126661044-126661066 CCAATAGGAGATAGATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104208195 Original CRISPR TCTGGGGAACTGTAATGCAG AGG (reversed) Intergenic
No off target data available for this crispr