ID: 1104209577

View in Genome Browser
Species Human (GRCh38)
Location 12:126675632-126675654
Sequence GTTCAGCAGCAGCAACATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104209576_1104209577 -5 Left 1104209576 12:126675614-126675636 CCAGAAGATCTACATTGTGTTCA No data
Right 1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104209577 Original CRISPR GTTCAGCAGCAGCAACATGT AGG Intergenic
No off target data available for this crispr