ID: 1104209959

View in Genome Browser
Species Human (GRCh38)
Location 12:126679180-126679202
Sequence AAATGTATGAAACAGCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104209958_1104209959 25 Left 1104209958 12:126679132-126679154 CCTGGATTGTTGATTTCTTCTTC No data
Right 1104209959 12:126679180-126679202 AAATGTATGAAACAGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104209959 Original CRISPR AAATGTATGAAACAGCTTCA TGG Intergenic
No off target data available for this crispr