ID: 1104211169

View in Genome Browser
Species Human (GRCh38)
Location 12:126690156-126690178
Sequence AGTTCATCCAGGTGTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104211167_1104211169 8 Left 1104211167 12:126690125-126690147 CCGAGAAAAGACAAGGTCATTTG 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1104211169 12:126690156-126690178 AGTTCATCCAGGTGTGATCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1104211166_1104211169 9 Left 1104211166 12:126690124-126690146 CCCGAGAAAAGACAAGGTCATTT 0: 1
1: 0
2: 1
3: 45
4: 335
Right 1104211169 12:126690156-126690178 AGTTCATCCAGGTGTGATCCTGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104211169 Original CRISPR AGTTCATCCAGGTGTGATCC TGG Intergenic
902883432 1:19387965-19387987 AGTGAATTCAGGTATGATCCAGG - Intronic
902956414 1:19926948-19926970 AGTTCATAAAGGTGGGAGCCAGG + Intergenic
902957002 1:19932240-19932262 AGTTCATAAAGGTGGGAGCCAGG + Intergenic
905483095 1:38275157-38275179 ATTTCCTCCAGCTCTGATCCGGG + Intergenic
906795395 1:48692670-48692692 AGGTGATCCAGGGGTGATCCAGG + Intronic
911707102 1:101026234-101026256 AGTTCAACTAGGTGTCTTCCTGG + Intergenic
912139771 1:106709583-106709605 TGTTCATCCAGGAGTTATTCAGG + Intergenic
915410636 1:155699058-155699080 AGTTCATAAAGGTGGGAGCCAGG + Intronic
915936772 1:160094151-160094173 AGTTCTTCCAGATGTCCTCCAGG - Exonic
917673321 1:177295326-177295348 TGTTCATCCAGGAGTTATTCAGG + Intergenic
918164098 1:181927838-181927860 ACTTCATCCAGCTGTGACCTAGG - Intergenic
919601076 1:199622785-199622807 AGTTACTCCCTGTGTGATCCTGG - Intergenic
920724034 1:208416777-208416799 AGGTCATGCAGGTCTGATGCAGG + Intergenic
921157970 1:212452933-212452955 AGTTGGTCCAGGAGTAATCCTGG - Intergenic
1070102561 10:73401873-73401895 AGATCAGCCAGGTGTGGTTCTGG - Intronic
1070918175 10:80168172-80168194 AGTTCCTCCAGGGTTGATCTTGG - Intronic
1073435628 10:103514058-103514080 AGTTCATCCAGGAGACCTCCTGG - Intronic
1075241945 10:120787158-120787180 TATTCATTCAGGTGTGATCACGG + Intergenic
1075986333 10:126788700-126788722 AGCTACTCCAGGTGTGACCCAGG + Intergenic
1078251738 11:9622288-9622310 CGTTCATCCCGGTGGGCTCCTGG + Intergenic
1078357405 11:10642588-10642610 AGGTCACCCAGGTGGGATTCTGG - Intronic
1078843454 11:15100623-15100645 AGACCATCCAGGTCTCATCCAGG - Intergenic
1084928387 11:72533251-72533273 AGTTCCTCCAGGTGTGAGGTTGG + Intergenic
1091722600 12:2824178-2824200 AGTACAGCTAGGTGGGATCCTGG - Exonic
1092129138 12:6096326-6096348 ACTGCCTCCAGGTGTGGTCCTGG + Intronic
1092572270 12:9738990-9739012 AGTTCCTCCCGGTGGGCTCCTGG + Intergenic
1093748307 12:22768729-22768751 AGTTTATCCTGGTGTTGTCCAGG - Intergenic
1095259177 12:40079193-40079215 AGTTCCTCTAGGTGTGATGCTGG + Intronic
1096636291 12:52961818-52961840 TCTTCATCCTGGTGTCATCCTGG + Intergenic
1098747307 12:74254878-74254900 GGTACATCCAGGTGTCATCCTGG + Intergenic
1104108657 12:125686476-125686498 AATTGATCCAGGTATGTTCCTGG + Intergenic
1104211169 12:126690156-126690178 AGTTCATCCAGGTGTGATCCTGG + Intergenic
1104720108 12:131040626-131040648 AGTTCACCTAGGTGTGCACCTGG - Intronic
1107427771 13:40311413-40311435 AGCTCAGCCACTTGTGATCCAGG + Intergenic
1107752515 13:43584072-43584094 AGTTCATGCTGCTGTGATTCTGG - Intronic
1109308831 13:60668852-60668874 AGTTCCTCTAGGTGTGATGTTGG + Intergenic
1113005211 13:105694293-105694315 AGTTTCTCCAGGTGTGCCCCTGG + Intergenic
1116723083 14:48525996-48526018 AATTCTTCCAGAGGTGATCCAGG + Intergenic
1116791760 14:49346851-49346873 AGTTTATCAAGGTGTGCTCTTGG - Intergenic
1117613152 14:57504687-57504709 AGTACATCCAGGTGTGTCCTGGG + Intergenic
1118470416 14:66069986-66070008 AGTTCAACCAGGAGAGATCCTGG + Intergenic
1120161744 14:81153103-81153125 AGTTCTTCCAGATGTAATACAGG - Intergenic
1120316893 14:82905842-82905864 CATTCATCCAGGTGTGATTCAGG - Intergenic
1120889084 14:89475853-89475875 AGTTTATCCAAGACTGATCCAGG + Intronic
1124149487 15:27164508-27164530 CTTTGATCCAGGTTTGATCCAGG + Intronic
1124511683 15:30332742-30332764 AGTTCATCCAGGTAGGATTTGGG - Intergenic
1124731231 15:32198015-32198037 AGTTCATCCAGGTAGGATTTGGG + Intergenic
1127020226 15:54738386-54738408 AGCTCACCCAGCTGTGATCATGG - Intergenic
1129184746 15:73899268-73899290 GGTGCATCCAGCTGTGAGCCAGG - Intergenic
1132940906 16:2507664-2507686 AGATTCTCCAGGTGTGCTCCTGG + Intronic
1134001399 16:10785841-10785863 AGTTCATAAAGGTGGGAGCCAGG - Intronic
1134001794 16:10788576-10788598 AGTTCATAAAGGTGGGAGCCAGG + Intronic
1140830358 16:78745180-78745202 AGTTCTTCCAGGAAAGATCCTGG - Intronic
1141441272 16:84031187-84031209 AATTCAGCCAGGTGTGATGGTGG - Intronic
1141689325 16:85587552-85587574 GGTACATCCAGGTACGATCCTGG + Intergenic
1145799421 17:27673538-27673560 AGTCCATCTAGGTGTTCTCCAGG - Intergenic
1149847929 17:60018201-60018223 GGTCCATCCAGGTGTTCTCCAGG - Intergenic
1150086284 17:62274818-62274840 AGTCCATCCAGGTGTTCTCCAGG - Intronic
1151880124 17:76889741-76889763 ATCCCATCCAGGTCTGATCCAGG + Intronic
1159021559 18:63147180-63147202 AGTTCCTCCACTTGTGGTCCAGG + Intronic
1162378633 19:10319282-10319304 AGTTCAGCCAGGGGTGAGGCTGG - Intronic
1163546444 19:17943735-17943757 AGTTCACCCACGGGTGGTCCAGG + Exonic
1163786475 19:19277375-19277397 AGCTCTCCCAGGTGTGACCCTGG - Intronic
1163824433 19:19515176-19515198 AGTTCATCGAGGTGTGCAACGGG - Exonic
1166424743 19:42667636-42667658 AGTTCATAAAGGTGGGAGCCAGG + Intronic
925976642 2:9146517-9146539 GGTTCAACCAGGTGTCAACCAGG - Intergenic
929771904 2:44899341-44899363 ATGTCACCAAGGTGTGATCCAGG - Intergenic
931974600 2:67629492-67629514 AGTTCAGCCAGCTCTGCTCCAGG + Intergenic
934724918 2:96610049-96610071 ACTAAATCCAAGTGTGATCCTGG + Intronic
936845584 2:116827262-116827284 GGTTCATCCATGTGTCATCAAGG + Intergenic
937318791 2:120948491-120948513 AGCTCCTCCATGTGTGACCCAGG + Intronic
939293212 2:140221697-140221719 AGTTCAGACTGGAGTGATCCAGG - Intergenic
942905313 2:181173534-181173556 ATTTTATCCACTTGTGATCCAGG + Intergenic
943792793 2:191953826-191953848 ATTTCTTCCAGGTGTGATGCTGG - Exonic
946381384 2:219351281-219351303 AGGTTGTCCAGGTGGGATCCTGG - Intergenic
946726878 2:222670363-222670385 AGTTAACCCAGGAGTCATCCGGG - Intergenic
948671065 2:239569234-239569256 GGTTCATCCAGGTGGAATCCTGG - Intergenic
949047789 2:241880097-241880119 TGTCTGTCCAGGTGTGATCCAGG + Intergenic
1172103563 20:32501128-32501150 ATCTCAACCAGGTGTGATCAAGG + Intronic
1172940417 20:38650083-38650105 AGTTCTTCCAGGGCTGATCATGG - Exonic
1174199722 20:48798716-48798738 AGCTCCTCCACGTGTGCTCCAGG - Intronic
1175904187 20:62371737-62371759 GGGGCATCCAGGTGGGATCCTGG - Intergenic
1177417500 21:20812976-20812998 AGTTCATCCAAATGTCTTCCTGG + Intergenic
1182760719 22:32720522-32720544 GGTTCAGCCAAGTGTGATTCGGG - Intronic
1183010122 22:34939357-34939379 TCTTCCTCCAGATGTGATCCAGG + Intergenic
1183781101 22:39999449-39999471 GGTTCATCTGGGTGTGAGCCAGG - Intronic
1184341947 22:43891050-43891072 AGCTCATCCAGGTGTGGGGCGGG - Exonic
950158919 3:10744163-10744185 AGTGCATCCTGGAGTGAGCCTGG - Intergenic
950586299 3:13894997-13895019 AGGGCATCCAGGTGTGATGTGGG + Intergenic
950772440 3:15323249-15323271 AGTCCATCCCGCTGTAATCCTGG + Intronic
954129661 3:48553961-48553983 AGTTCCTCCAGGTCTGAGCTCGG + Intronic
955419782 3:58724733-58724755 AGTTCATAAAGGTGGGAGCCAGG - Intronic
963403712 3:144836091-144836113 ATTTCATCCAGGTTTAATCTTGG + Intergenic
967684242 3:192400785-192400807 AGTTCAGCCAGGGATTATCCAGG + Intronic
968286744 3:197513300-197513322 AGCCCATCCAGGTGTGTCCCGGG + Intronic
968286754 3:197513333-197513355 AGCCCATCCAGGTGTGTCCCCGG + Intronic
968286765 3:197513366-197513388 AGCCCATCCAGGTGTGCCCCCGG + Intronic
968286777 3:197513399-197513421 AGCCCATCCAGGTGTGCCCCCGG + Intronic
968286791 3:197513432-197513454 AGCCCATCCAGGTGTGCCCCCGG + Intronic
968286803 3:197513465-197513487 AGCCCATCCAGGTGTGCCCCCGG + Intronic
968286815 3:197513498-197513520 AGCCCATCCAGGTGTGTCCCCGG + Intronic
968286826 3:197513531-197513553 AGCCCATCCAGGTGTGTCCCCGG + Intronic
968447094 4:657599-657621 AGGTCATCCAGGGGTCACCCAGG + Intronic
969137480 4:5042374-5042396 ACTTCATCCATCTGTGAGCCAGG + Intergenic
969241083 4:5898134-5898156 AGTTCTTCCAGGTTGAATCCTGG - Intronic
972143156 4:35986759-35986781 AGCTCCTCCAGGTGTGATGTTGG - Intronic
975055552 4:69924879-69924901 AGTTCTTCCAGGTGGGCTCGTGG - Intergenic
975941709 4:79655882-79655904 AGTTCCTCTAGGTGTGATATTGG + Intergenic
979569563 4:122202471-122202493 AGCTCAACCAAGTGTGACCCTGG - Intronic
979907186 4:126309538-126309560 AGTTCCTCTAGGTATGATACTGG - Intergenic
980081437 4:128348904-128348926 AGTTCATCTAGGGGTGATTGAGG + Intergenic
981489762 4:145327092-145327114 AGTACATCCAGGGGTGCTCAAGG - Intergenic
981924754 4:150126852-150126874 AGTAAATCCATGTGGGATCCTGG - Intronic
982220963 4:153125009-153125031 AGTTCTTCTAGTTCTGATCCTGG - Intergenic
982901227 4:161004779-161004801 AGTTCAATCATGTTTGATCCAGG - Intergenic
984071727 4:175122484-175122506 TGTTCACCCAGGTGTTATTCAGG - Intergenic
987238735 5:15970620-15970642 GGATCAACCAAGTGTGATCCTGG - Intergenic
989597976 5:43174752-43174774 AGTCCATCCAGATCTGCTCCAGG + Exonic
989992131 5:50779454-50779476 AGTTGATGCAGGTGTCATCTAGG + Intronic
990373021 5:55140093-55140115 AGTTCTTCCAGCTGTCCTCCTGG - Intronic
995334450 5:110983523-110983545 AGTACAGCTAGGTGGGATCCTGG + Intergenic
996599399 5:125244465-125244487 AGTTCCTCTAGGTGTGATATTGG + Intergenic
1000909019 5:166998422-166998444 GGTTCATCCAGGTGTAATTTAGG - Intergenic
1005311578 6:24564190-24564212 AGTGCAGCCAGGTGAGTTCCTGG - Exonic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1008078429 6:47170014-47170036 ATTTCATCCATTTGTGATACTGG + Intergenic
1009034588 6:58101039-58101061 CGTTCATCCAGGAGTTATTCAGG - Intergenic
1009456233 6:63859801-63859823 AATTCATCCAGGGGTAATCGTGG - Intronic
1010066812 6:71691904-71691926 AATTCATCCAGTTATGATCAAGG + Intergenic
1013255017 6:108376378-108376400 AGTTCTTCTAGGTGTGATGTTGG + Intronic
1014852501 6:126359179-126359201 TGTTCATCCAGGAGTTATTCAGG + Intergenic
1015574214 6:134653687-134653709 AGTTCCTCAAGGTGTGATGGTGG - Intergenic
1017629086 6:156378897-156378919 ATTTCATCAAGGTGAGAACCAGG - Intergenic
1019288846 7:237261-237283 AGTTCATGCACGTGGAATCCAGG - Intronic
1021006042 7:15396305-15396327 TCTTCCTCCAGGTGTGTTCCTGG + Intronic
1022639248 7:32165834-32165856 TGGTTCTCCAGGTGTGATCCTGG + Intronic
1023833156 7:44051956-44051978 GTTTCATCTAGGTGTGACCCAGG + Intronic
1024486874 7:49929251-49929273 AGTTCATCTTCCTGTGATCCAGG - Intronic
1026373054 7:69721119-69721141 TGTTCATCCAGGTTTGAGCAGGG + Intronic
1029866491 7:103636457-103636479 ATTTCTTTCAGGTGTGACCCTGG - Exonic
1035325245 7:158061718-158061740 AGGTCCTTCAGGTGTGGTCCTGG - Intronic
1036582439 8:10087979-10088001 AGTTAATGCAGGGGTGATCTAGG + Intronic
1036785275 8:11681395-11681417 AGTTGAGCCACGCGTGATCCCGG - Intronic
1037945179 8:22985170-22985192 AGTTCATAAAGGTGGGAGCCAGG + Intronic
1037977711 8:23225019-23225041 AGTACATCTAGGTGCGTTCCTGG - Exonic
1038269274 8:26062114-26062136 TGTGCATTCACGTGTGATCCAGG + Intergenic
1038661869 8:29504500-29504522 ATCTCATCCAGGTGTGAGTCTGG + Intergenic
1042629480 8:70801233-70801255 AGTTCCTCTAGGTGTGGTGCTGG + Intergenic
1044113958 8:88311296-88311318 AGATCATCAAAGTTTGATCCAGG + Intronic
1047161919 8:122390192-122390214 GTTTCATCCATGTGTTATCCTGG - Intergenic
1047926663 8:129689110-129689132 AGTTCCTCACTGTGTGATCCTGG - Intergenic
1048552842 8:135449490-135449512 AATTCAGCCAGGTATGACCCAGG - Intergenic
1049518911 8:143078304-143078326 ACTGCATCCAGCTGTGCTCCTGG - Intergenic
1056593422 9:87984226-87984248 AGTTCATAAAGGTGGGAGCCAGG + Intergenic
1057299746 9:93870947-93870969 AGTTCATCCCGGGGTGAGCCGGG - Intergenic
1058448721 9:105076699-105076721 ATTTCAACCTGGTGTGCTCCTGG - Intergenic
1059829756 9:118082290-118082312 AATTCATCCTGTTGTGTTCCTGG - Intergenic
1061194749 9:129101732-129101754 AGTTCATGAAGGTGGGAGCCAGG - Intronic
1061505736 9:131030946-131030968 AGTGCATCCTGGGGTGATCCAGG + Intronic
1188989691 X:36802565-36802587 AGATCATTCAAGTGTAATCCAGG - Intergenic
1189273726 X:39769852-39769874 AGTTCCTCCAAGTGTGGTCCAGG + Intergenic
1190556048 X:51636960-51636982 AGTTCATAAAGGTGGGAGCCAGG - Intergenic
1200926227 Y:8657408-8657430 GGTTCATCCTGGTGTTATCCAGG + Intergenic
1201377079 Y:13334206-13334228 AGTTCATAAAGGTGGGAGCCAGG - Intronic
1201642379 Y:16193307-16193329 AGTTCATCAAGATGTCAACCTGG - Intergenic
1201660435 Y:16392013-16392035 AGTTCATCAAGATGTCAACCTGG + Intergenic
1201695966 Y:16826473-16826495 ACTTAATCCAGTTGTGATCCAGG - Intergenic