ID: 1104215548

View in Genome Browser
Species Human (GRCh38)
Location 12:126729334-126729356
Sequence TCTAAGATTTAGTATGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104215544_1104215548 -4 Left 1104215544 12:126729315-126729337 CCACCACGCCCGGCTAGGTTCTA No data
Right 1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG No data
1104215541_1104215548 23 Left 1104215541 12:126729288-126729310 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG No data
1104215545_1104215548 -7 Left 1104215545 12:126729318-126729340 CCACGCCCGGCTAGGTTCTAAGA No data
Right 1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG No data
1104215540_1104215548 24 Left 1104215540 12:126729287-126729309 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG No data
1104215538_1104215548 27 Left 1104215538 12:126729284-126729306 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104215548 Original CRISPR TCTAAGATTTAGTATGTAAA AGG Intergenic
No off target data available for this crispr