ID: 1104216436

View in Genome Browser
Species Human (GRCh38)
Location 12:126738579-126738601
Sequence AGATTAACGCAACTACCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104216436_1104216442 12 Left 1104216436 12:126738579-126738601 CCTTAAGGTAGTTGCGTTAATCT No data
Right 1104216442 12:126738614-126738636 ATAAAATACCATAGGCTGGGTGG No data
1104216436_1104216439 8 Left 1104216436 12:126738579-126738601 CCTTAAGGTAGTTGCGTTAATCT No data
Right 1104216439 12:126738610-126738632 TGCCATAAAATACCATAGGCTGG No data
1104216436_1104216440 9 Left 1104216436 12:126738579-126738601 CCTTAAGGTAGTTGCGTTAATCT No data
Right 1104216440 12:126738611-126738633 GCCATAAAATACCATAGGCTGGG No data
1104216436_1104216438 4 Left 1104216436 12:126738579-126738601 CCTTAAGGTAGTTGCGTTAATCT No data
Right 1104216438 12:126738606-126738628 GTACTGCCATAAAATACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104216436 Original CRISPR AGATTAACGCAACTACCTTA AGG (reversed) Intergenic