ID: 1104216929

View in Genome Browser
Species Human (GRCh38)
Location 12:126742555-126742577
Sequence TTCTCTTGGCACCGCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104216921_1104216929 11 Left 1104216921 12:126742521-126742543 CCCCGAAGCTCTTTGAGGCTTCT No data
Right 1104216929 12:126742555-126742577 TTCTCTTGGCACCGCCGGGCTGG No data
1104216920_1104216929 12 Left 1104216920 12:126742520-126742542 CCCCCGAAGCTCTTTGAGGCTTC No data
Right 1104216929 12:126742555-126742577 TTCTCTTGGCACCGCCGGGCTGG No data
1104216922_1104216929 10 Left 1104216922 12:126742522-126742544 CCCGAAGCTCTTTGAGGCTTCTC No data
Right 1104216929 12:126742555-126742577 TTCTCTTGGCACCGCCGGGCTGG No data
1104216923_1104216929 9 Left 1104216923 12:126742523-126742545 CCGAAGCTCTTTGAGGCTTCTCT No data
Right 1104216929 12:126742555-126742577 TTCTCTTGGCACCGCCGGGCTGG No data
1104216918_1104216929 23 Left 1104216918 12:126742509-126742531 CCATTAGCTTTCCCCCGAAGCTC No data
Right 1104216929 12:126742555-126742577 TTCTCTTGGCACCGCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104216929 Original CRISPR TTCTCTTGGCACCGCCGGGC TGG Intergenic
No off target data available for this crispr