ID: 1104217284

View in Genome Browser
Species Human (GRCh38)
Location 12:126746628-126746650
Sequence CCAAGTGCACACCCATAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104217282_1104217284 22 Left 1104217282 12:126746583-126746605 CCTTCTGTCATAGGGTAAAACTT No data
Right 1104217284 12:126746628-126746650 CCAAGTGCACACCCATAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104217284 Original CRISPR CCAAGTGCACACCCATAGAT TGG Intergenic
No off target data available for this crispr