ID: 1104218661

View in Genome Browser
Species Human (GRCh38)
Location 12:126760448-126760470
Sequence CCAACAGATATTTACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104218661_1104218667 25 Left 1104218661 12:126760448-126760470 CCCACTGTGTAAATATCTGTTGG No data
Right 1104218667 12:126760496-126760518 TGATGACAGTCTATTATGACAGG No data
1104218661_1104218668 26 Left 1104218661 12:126760448-126760470 CCCACTGTGTAAATATCTGTTGG No data
Right 1104218668 12:126760497-126760519 GATGACAGTCTATTATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104218661 Original CRISPR CCAACAGATATTTACACAGT GGG (reversed) Intergenic
No off target data available for this crispr