ID: 1104225593

View in Genome Browser
Species Human (GRCh38)
Location 12:126829839-126829861
Sequence CTCATCCTGACGTGCAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104225592_1104225593 28 Left 1104225592 12:126829788-126829810 CCTAGGACAGAAGATGTGTTTTT No data
Right 1104225593 12:126829839-126829861 CTCATCCTGACGTGCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104225593 Original CRISPR CTCATCCTGACGTGCAATCA TGG Intergenic
No off target data available for this crispr